We narrowed to 26,996 results for: ung
-
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
psiCHECK3-EIF3B-1-147
Plasmid#136020PurposeEIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-464
Plasmid#136023PurposeEIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Unstructured
Plasmid#136026PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-Unstructured-EIF3B
Plasmid#136027PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDSM-de-Phhf2-PYC-Tadh1
Plasmid#127737PurposeYeast pathway position 5. PYC transcription unit with the HHF2 promoter and ADH1 terminator.DepositorInsertpyruvate carboxylase (PYC1 Synthetic, Budding Yeast)
UseSynthetic BiologyExpressionYeastPromoterPhhf2Available SinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJSC176 - Bacterial expression plasmid for SpCas9 + Q926A variant
Plasmid#101206PurposeBacterial expression plasmid for SpCas9 + Q926A variantDepositorInsertSpCas9 variant Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationQ926APromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMYA5T2/pDEST17
Plasmid#98118PurposeExpress CMYA5 (aa 4039 – 4069) Leu allele (4063) witha N-terminal 6x-His tag in bacteriaDepositorInsertCMYA5 (CMYA5 Human)
Tags6X-HisExpressionBacterialMutationrs10043986 (NP_705838.3:p.Pro4063Leu)Available SinceAug. 21, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMYA5T/pACT2
Plasmid#97209PurposeCMYA5 (aa 4039 – 4069) Leu allele (4063) in a GAL4 AD vector, used for yeast-two hybridDepositorAvailable SinceAug. 21, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
-
-
-
-
-
-