We narrowed to 1,990 results for: pCAG
-
Plasmid#114081PurposeCAG promoter expression plasmid for human codon optimized enAsBE1.1DepositorInsertDNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to N-terminal rAPOBEC1 and C-terminal UGI (enAsBE1.1)
TagsSV40 NLSExpressionMammalianMutationE174R, S542R, K548R and D908A, human codon optimi…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-NLS(SV40)x2-rAPOBEC1-gs-XTEN-gs-hdenAsCas12a(E174R/S542R/K548R/D908A)-NLS(nucleoplasmin)-gs-UGI-NLS(SV40)(enAsBE1.2)
Plasmid#114082PurposeCAG promoter expression plasmid for human codon optimized enAsBE1.2, also called RTW1348DepositorInsertDNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to N-terminal rAPOBEC1 and C-terminal UGI (enAsBE1.2)
Tags2x SV40 NLS and SV40 NLSExpressionMammalianMutationE174R, S542R, K548R and D908A, human codon optimi…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP416
Plasmid#134996PurposedCas9-m6A Writer. Methylates adenines at local GATC sites. pCAG-dCas9-NLS-3xFLAG-3AC3L linker-EcoDam(N132A)DepositorInsertpCAG-dCas9-NLS-3xFLAG-3AC3L linker-EcoDam(N132A)
UseSynthetic BiologyTags3xFLAG, E coli Dam(N132A), and dCas9ExpressionMammalianAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTK2_005
Plasmid#123700PurposeEncodes pCAG as a Type 2 part to be used in the MTK systemDepositorInsertpCAG
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-NeoR-CAG-EGFPnls-WPRE
Plasmid#191692PurposeFor knocking pCAG-EGFPnls into AAVS1 locusDepositorInsertAAVS1 homology arms and pCAG-EGFPnls
ExpressionMammalianMutationWTAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLXIN2-RFP
Plasmid#99205PurposeRFP expressing bicistronic retroviral vectorDepositorInsertRed fluorescent protein
UseRetroviral; Bicistronic retroviral expression vec…ExpressionMammalianMutationThe dsRed cDNA was PCR amplified off AddGene plas…Available SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9_GFP
Plasmid#64709PurposeCo-expression of human codon-optimized Staphylococcus aureus Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells and other mammalian cellsDepositorInsertSaCas9-2A-GFP
UseCRISPRTags2A-GFP and 3xFLAG-SV40 NLSExpressionMammalianPromoterCAGAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
-