We narrowed to 7,583 results for: PAC;
-
Plasmid#158635PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorInsertMAVS (MAVS Human)
UseLentiviralTags3XFLAGExpressionMutationE93QPromoterAvailable sinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
C-Terminal Split Cas9 with GyrA intein
Plasmid#58694PurposeExpresses truncated C-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with N-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized C-Terminal S. pyogenes Cas9 with GyrA Csplit Intein
UseAAV and CRISPRTagsGyrA Csplit Intein and NLSExpressionMammalianMutationPromoterCBhAvailable sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 with GyrA intein
Plasmid#58693PurposeExpresses truncated N-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized N-Terminal S. pyogenes Cas9 with GyrA Nsplit Intein
UseAAV and CRISPRTags3xFlag, GyrA Nsplit Intein, and NLSExpressionMammalianMutationPromoterCBhAvailable sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-PSAT1
Plasmid#83908Purposestable overexpressionDepositorInsertphosphoserine aminotransferase 1 (PSAT1 Human)
UseTags6x His tagsExpressionBacterialMutationPromoterT7Available sinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianMutationPromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM5-mSHMT2
Plasmid#83905Purposestable overexpressionDepositorInsertSerine hydroxymethyltransferase 2 (Shmt2 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-PSPH
Plasmid#83909Purposestable overexpressionDepositorInsertphosphoserine phosphatase (PSPH Human)
UseTags6x His tagsExpressionBacterialMutationPromoterT7Available sinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-8D2Q.Tau2N4R-WPRE
Plasmid#226382PurposeExpresses tau propagation ORF with V5 tag on 8D2Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T.2A.V5ExpressionMammalianMutation8D2Q.Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-20D3Q.Tau2N4R-WPRE
Plasmid#226383PurposeExpresses tau propagation ORF with V5 tag on 20D3Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T.2A.V5ExpressionMammalianMutation20D3Q, Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-8A2R.Tau2N4R-WPRE
Plasmid#226384PurposeExpresses tau propagation ORF with V5 tag on 8A2R mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T.2A.V5ExpressionMammalianMutation8A2R, Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-20A3R.Tau2N4R-WPRE
Plasmid#226385PurposeExpresses tau propagation ORF with V5 tag on 20A3R mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T.2A.V5ExpressionMammalianMutation20A3R, Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-K281Q.Tau2N4R-WPRE
Plasmid#226386PurposeExpresses tau propagation ORF with V5 tag on K281Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T.2A.V5ExpressionMammalianMutationK281Q, 2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-K353Q.Tau2N4R-WPRE
Plasmid#226387PurposeExpresses tau propagation ORF with V5 tag on K353Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T.2A.V5ExpressionMammalianMutationK353Q, 2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-S198D.Tau2N4R-WPRE
Plasmid#226388PurposeExpresses tau propagation ORF with V5 tag on S189D mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T.2A.V5ExpressionMammalianMutationS198D.Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-S199D.Tau2N4R-WPRE
Plasmid#226389PurposeExpresses tau propagation ORF with V5 tag on S199D mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T-2A-V5ExpressionMammalianMutationS199D, Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-S202D.Tau2N4R-WPRE
Plasmid#226390PurposeExpresses tau propagation ORF with V5 tag on S202D mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T.2A.V5ExpressionMammalianMutationS202D, Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-S404D.Tau2N4R-WPRE
Plasmid#226391PurposeExpresses tau propagation ORF with V5 tag on S404D mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T.2A.V5ExpressionMammalianMutationS404D, Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-T217D.Tau2N4R-WPRE
Plasmid#226392PurposeExpresses tau propagation ORF with V5 tag on T217D mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsTagRFP.T.2A.V5ExpressionMammalianMutationT217D, Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only