We narrowed to 17,901 results for: REV
-
Plasmid#232738PurposeExpresses NADPH/NADP+ biosensor NAPstar1 in S. cerevisiae.DepositorInsertNAPstar1
UseTagsExpressionYeastMutationPromoterAvailable sinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar2
Plasmid#232739PurposeExpresses NADPH/NADP+ biosensor NAPstar2 in S. cerevisiae.DepositorInsertNAPstar2
UseTagsExpressionYeastMutationPromoterAvailable sinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar4
Plasmid#232741PurposeExpresses NADPH/NADP+ biosensor NAPstar4 in S. cerevisiae.DepositorInsertNAPstar4
UseTagsExpressionYeastMutationPromoterAvailable sinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar6
Plasmid#232742PurposeExpresses NADPH/NADP+ biosensor NAPstar6 in S. cerevisiae.DepositorInsertNAPstar6
UseTagsExpressionYeastMutationPromoterAvailable sinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar7
Plasmid#232744PurposeExpresses NADPH/NADP+ biosensor NAPstar7 in S. cerevisiae.DepositorInsertNAPstar7
UseTagsExpressionYeastMutationPromoterAvailable sinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q63/67A
Plasmid#217439PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q63A,Q67A mutations in CA).DepositorInsertgag/pol
UseLentiviralTagsExpressionMutationCA Q63A,Q67APromoterAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q67H/N74D
Plasmid#217441PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef. Contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q67H,N74D mutations in CA).DepositorInsertgag/pol
UseLentiviralTagsExpressionMutationCA Q67H,N74DPromoterAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only