We narrowed to 5,874 results for: ATC
-
Plasmid#25762PurposeEntry vector with TRE promoter driving mouse G alpha 13 miR30-based shRNA.DepositorInsertG alpha 13 miR-shRNA
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAG226 SFRS12 3'UTR mut
Plasmid#12045DepositorInsertSFRS12 3'UTR mut (SREK1 Human)
UseLuciferaseTagsExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…PromoterAvailable sinceJune 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAG220 CASC2 3'UTR mut
Plasmid#12050DepositorInsertN21 3'UTR mutant (CASC2 Human)
UseLuciferaseTagsExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…PromoterAvailable sinceJune 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAG183 SRPK2 3'UTR mut
Plasmid#12041DepositorInsertN16 3'UTR mut (SRPK2 Human)
UseLuciferaseTagsExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…PromoterAvailable sinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAG218 NID1 3'UTR mut
Plasmid#12048DepositorInsertN19 3'UTR mut (NID1 Human)
UseLuciferaseTagsExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…PromoterAvailable sinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAG81 ZAP3 3'UTR mut
Plasmid#12057DepositorInsertN3 3'UTR mut (YLPM1 Human)
UseLuciferaseTagsExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…PromoterAvailable sinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
JBL6424
Plasmid#183861PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Mismatch Invader B regulated sfGFP
UseTagsExpressionBacterialMutationPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6427
Plasmid#183864PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Mismatch Incumbent B regulated sfGFP
UseTagsExpressionBacterialMutationPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6419
Plasmid#183856PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Mismatch Invader A regulated sfGFP
UseTagsExpressionBacterialMutationPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6422
Plasmid#183859PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Mismatch Incumbent A regulated sfGFP
UseTagsExpressionBacterialMutationPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330 - LRR1 Terminal CRISPR
Plasmid#221705PurposeCas9 targeting plasmid with gRNA specific for LRR1 N-terminusDepositorInsertTGTAGCTTCATCTCGCCCAA
UseCRISPRTagsExpressionMutationPromoterChicken Beta-actinAvailable sinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp4
Plasmid#238037PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp1
Plasmid#238034PurposeEncodes sfGFPunder lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp2
Plasmid#238035PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp3
Plasmid#238036PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp6
Plasmid#238039PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp5
Plasmid#238038PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…TagsExpressionMammalianMutationPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-SnoopTag-SpyTag-(AffiHER2)x3
Plasmid#216281PurposeThree affibodies to HER2 linked in a chain for bacterial expression. SnoopTag and SpyTag allow isopeptide bond formation to their cognate CatcherDepositorInsertSnoopTag-SpyTag-(AffiHER2)x3
UseAffinity Reagent/ AntibodyTagsHis6, SnoopTag, and SpyTagExpressionBacterialMutationPromoterT7 promoterAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g2 LentiCRISPRv2-mCherry
Plasmid#218663PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorInsertGOLIM4 (GOLIM4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only