We narrowed to 860 results for: lenti crispr v2
-
Plasmid#186156PurposesgRNA targeting murine Msh2 geneDepositorAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only
-
LentiCRISPRv2-sgSORCS2-G2
Plasmid#118416PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting Human SORCS2DepositorInsertgRNA SORCS2 Human (SORCS2 Human)
UseCRISPR and LentiviralAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
p8389 LentiCRISPRv2 Neo sgNT-1
Plasmid#221649PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-1
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8390 LentiCRISPRv2 Neo sgNT-2
Plasmid#221650PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-2
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-V2_hMSH2
Plasmid#186155PurposesgRNA targeting human MSH2 geneDepositorAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-Beclin1
Plasmid#99574PurposeExpressed Cas9 with sgRNA targeting Beclin1DepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-bleo-ErbB4
Plasmid#197353PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
V2-MESA-35F-M-dCas9
Plasmid#84506PurposeMESA target chain with V2-MESA ectodomain, 35 extracellular linkers, a flag tag, M cleavage sequence, and dCas9-VP64DepositorInsertV2-MESA-35F-M-dCas9
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2GFP
Plasmid#82416Purpose3rd generation lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning siteDepositorInsertGFP
UseCRISPR and LentiviralPromoterEFS (P2A)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-E
Plasmid#78852PurposeIntroduce sgRNA into a lentiviral vector (LentiCRISPR V2) which contains eSpCas9 and puromycin cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsCas9-P2A-PuroExpressionMammalianAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-1- LentiCRISPRv2
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ATG5
Plasmid#99573PurposeExpresses Cas9 with sgRNA targeting Exon 7 of ATG5DepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
p8391 LentiCRISPRv2 Neo sgPTPN14-1
Plasmid#221651PurposeExpression of sgRNA targeting the locus of human PTPN14DepositorInsertsgPTPN14-1 (PTPN14 Human)
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8392 LentiCRISPRv2 Neo sgPTPN14-3
Plasmid#221652PurposeExpression of sgRNA targeting the locus of human PTPN14DepositorInsertsgPTPN14-3 (PTPN14 Human)
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2Cre
Plasmid#82415PurposeLentiviral vector expressing Cre recombinase alongside Cas9 and an sgRNA cloning siteDepositorInsertCre Recombinase
UseCRISPR, Cre/Lox, and LentiviralMutationMutated BsmBI cut sitePromoterEFS (P2A)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_puro_FAM136A_sg1
Plasmid#244877PurposeKnockout of human FAM136ADepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only