We narrowed to 8,917 results for: c myc plasmid
-
Plasmid#149421PurposePlasmid for STARR-seq in tobacco leaves. Enhancer candidates can be inserted into the IV2 intron in the GFP reporter gene.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pGT-Ah7
Plasmid#122574PurposeMAGIC donor plasmid (Himar transposon with catP/sfGFP payload)DepositorInsertcatP/sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGT-Ah6
Plasmid#122573PurposeMAGIC donor plasmid (Himar transposon with catP/sfGFP payload)DepositorInsertcatP/sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-PAX6a
Plasmid#222576PurposePiggyBac transposon plasmid for doxycycline inducible expression of PAX6aDepositorInsertPAX6a (PAX6 Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPSdown
Plasmid#149417PurposePlasmid for STARR-seq in tobacco leaves. Enhancer candidates can be inserted into the 3'-UTR of the GFP reporter gene.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPSdown2
Plasmid#149419PurposePlasmid for STARR-seq in tobacco leaves. Enhancer candidates can be inserted downstream of the GFP reporter gene.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGT-Ah5
Plasmid#122572PurposeMAGIC donor plasmid (Himar transposon with catP/sfGFP payload)DepositorInsertcatP/sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a_LolT_C41S
Plasmid#211789PurposeExpression plasmid in E. coli BL21(DE3) , which can be used for expression and purification to get protein LolT_C41SDepositorInsertlolt mutant
TagsHis tagExpressionBacterialPromoterT7 promoterAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
p416TEF1 Cystector (Cysteine biosensor)
Plasmid#250654PurposeCytosolic expression plasmid for Cystector (Cysteine biosensor) in Saccharomyces cerevisiaeDepositorInsertCystector (Cysteine biosensor)
ExpressionYeastPromoterTEF1Available SinceMarch 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-PAX6b
Plasmid#222577PurposePiggyBac transposon plasmid for doxycycline inducible expression of PAX6bDepositorInsertPAX6b (PAX6 Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJLG029
Plasmid#192980PurposeBHR plasmid (pRA301) expressing pruR-3XFLAG from T7 promoter for high yield protein purificationDepositorInsertpruR-3xFLAG
Tags3XFLAGExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMAT36
Plasmid#192979PurposeBHR plasmid (pRA301) expressing mirA-3XFLAG from T7 promoter for high yield protein purificationDepositorInsertmirA-3xFLAG
Tags3XFLAGExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_i1
Plasmid#231416PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-1.DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICE-RNaseHI-D10R-E48R-NLS-mCherry
Plasmid#60367PurposePlasmid for expression of an inactive mutant of bacterial RNase HI tagged with NLS-mCherry that can be used to detect R-loops. Confers resistance to Puromycin. Expression is inducible in T-REx cells.DepositorInsertRNase HI-D10R-E48R
TagsNLS from SV40 T antigen and mCherryExpressionMammalianMutationD10R+E48R; catalyticaly inactivePromoterCMV-tetAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_-20G_1333CN
Plasmid#186200PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted 20th G to A of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1333C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1333N of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_ -13G_1397CN
Plasmid#186199PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted -13th G to A of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1397C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1397N of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only