We narrowed to 77,498 results for: Rest
-
Plasmid#50864PurposeExpresses human NKCC1 A675C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationA675C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 S679C I730C (NT838)
Plasmid#50869PurposeExpresses human NKCC1 S679C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationS679C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I674C I730C (NT835)
Plasmid#50863PurposeExpresses human NKCC1 I674C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI674C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I677C A734C (NT813)
Plasmid#50868PurposeExpresses human NKCC1 I677C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI677C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUCM-AAVS1-TO-hNGN2
Plasmid#105840PurposeDonor construct for introduction of NGN2 into AAVS1 safe harbor site and iPSC differentiation to cortical neuronDepositorInsertsUseCRISPR and TALENPromoterCAG, EF-1alpha, and TRE3GAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX MLKL(wt)--2A-mCherry-puro
Plasmid#231974PurposeTet inducible expression of DmrB-Mlkl with mCherry to induce WT Mlkl expressionDepositorAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
TGFB1_pLX307
Plasmid#98377PurposeLentiviral expression of TGFB1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-STING-sh5
Plasmid#127647PurposeKnock-down of human STINGDepositorInsertSTING shRNA (STING1 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.eC
Plasmid#201903Purposenon-standard AAV2 rep-AAV-PHP.eC cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.eC VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
MYC_pLX307
Plasmid#98363PurposeLentiviral expression of MYCDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-MTS-TagBFP-P2AT2A-EGFP-NLS-P2AT2A-mCherry-PTS1
Plasmid#87829PurposeHigh-efficient mammalian expression vector for co-expression of BFP-, EGFP- and mCherry-tagged proteins using P2AT2A. MTS, NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsMTS
NLS
PTS1
ExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-mCherry-sspB
Plasmid#121968PurposeExpresses fusion of disordered protein BRD4(462-1362), fluorescent protein mCherry, and sspB which upon light activation binds to iLID.DepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsmCherry-sspBExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-HLA-A0201-His
Plasmid#108213PurposeHLA-A0201 his taggedDepositorInsertmajor histocompatibility complex, class I, B (HLA-A Human)
UseEntry vector for gateway systemTagshisAvailable SinceDec. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RBM45_WT
Plasmid#82892PurposeGateway Donor vector containing RBM45, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV[Tet]-Puro-TRE3G>mMyod1[NM_010866.2]
Plasmid#184380PurposeThe mouse Myod1 gene is expressed under a doxcycline-inducible TRE3G promoterDepositorInsertMyod1 (Myod1 Mouse)
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pENTR-ABCC1_STOP
Plasmid#221423PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertABCC1 (ABCC1 Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
JUP_pLX307
Plasmid#98347PurposeLentiviral expression of JUPDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pErCas12a EZ Clone
Plasmid#132641PurposeExpresses ErCas12a and an sgRNA to target a region of interestDepositorInsertErCas12a
UseAAV and CRISPRTags3x HA and SV40 NLSExpressionMammalianMutationQ926R (Please see depositor comments) and BsaI si…PromoterCMV PromoterAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only