We narrowed to 7,094 results for: plasmid dna
-
Plasmid#184998PurposeExpress -Eco1 EMX1 editing ncRNA and gRNADepositorInsertEco1: EMX1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationEMX1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.175
Plasmid#184996PurposeExpress -Eco1 HEK3 editing ncRNA and gRNADepositorInsertEco1: HEK3 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK3 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
QSOX1-luciferase
Plasmid#113352Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of QSOX1 geneDepositorInsertQSOX1-enhancer (QSOX1 Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCL.180
Plasmid#185001PurposeExpress -Eco1 AAVS1 editing ncRNA and gRNADepositorInsertEco1: AAVS1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationAAVS1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2-miR-34 MT
Plasmid#78259PurposepsiCHECK2 dual luciferase reporter harboring a mutated miR-34 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase geneDepositorInsertmutated miR-34 target site
UseLuciferase; Microrna activityExpressionMammalianMutationnucleotides 2-5 and 10-11 changed from CCGT to GG…Available SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATP9A-luciferase
Plasmid#113354Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of ATP9A geneDepositorInsertATP9A-enhancer (ATP9A Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRDA_791
Plasmid#216079PurposeMinimal plasmid; contains only ori and ampR, destination vectorDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseDestinationExpressionBacterialAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KMT2B
Plasmid#101070PurposeDonor vector for 3' FLAG tag of human KMT2BDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZJQIBEBT003
Plasmid#140053PurposeThe pZJQIBEBT003 plasmid contains the coding sequence of eMutS-L157C-G233C gene which has the ability of error removal in the gene synthesis process.DepositorInserteMutS-L157C-G233C-CBM-EGFP
TagsHis-TagExpressionBacterialMutationL157C, G233CPromoterT7Available SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6.gLacZ.Cas9-T2A-GFP
Plasmid#170361PurposeNegative control plasmid used for Crispr/cas9 based disruption.DepositorInsertCas9-T2A-GFP
UseLentiviralPromoterU6Available SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_ARID4B
Plasmid#101072PurposeDonor vector for 3' FLAG tag of human ARID4BDepositorAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_RERE
Plasmid#101069PurposeDonor vector for 3' FLAG tag of human REREDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RERE_1
Plasmid#101073PurposeEncodes gRNA for 3' target of human REREDepositorInsertgRNA against RERE (RERE Human)
UseCRISPRAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-TAF1-A
Plasmid#247346PurposeExpresses SpCas9 and a sgRNA targeting the human TAF1-A loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GT-Dox-AIO-TetOn_ETV2_Down-Tandem
Plasmid#241393PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of ETV2DepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Nme2-U6-sgRNA scaffold
Plasmid#226933PurposeEncoding Nme2ABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nNme2Cas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-SaKKH-U6-sgRNA scaffold
Plasmid#226935PurposeEncoding SaKKHABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSaKKHCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA201
Plasmid#216026PurposeFragmid fragment: (Cas protein) firefly luciferaseDepositorHas ServiceCloning Grade DNAInsertFluc_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only