We narrowed to 8,876 results for: sgrna
-
Plasmid#183872PurposepX459V2.0 plasmid expressing HypaCas9 with P2A-mRuby2 and T2A-Puro, with a sgRNA cloning site for CRISPR editing in mammalian cells.DepositorTypeEmpty backboneUseCRISPRTagsHypaCas9-P2A-mRuby2-T2A-PuroExpressionMammalianPromoterCbhAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only
-
sgTrack-GFP
Plasmid#114012PurposeEmpty sgRNA expression vector with co-expression of TurboGFP reporterDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC-ARS-CRISPR-v2
Plasmid#99863PurposeExpresses Cas9-Nlux and sgRNA. Compact backbone contains CEN/ARS. Hygromycin selection marker.DepositorTypeEmpty backboneUseAlgae, nannochloropsisPromoterRibiAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT11
Plasmid#223383PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT08
Plasmid#223380PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEC726
Plasmid#190814PurposeCRISPRi backbone plasmid harboring BbsI sites for easy cloning of sgRNA targeting regions via Golden gate.DepositorInsertdCas9
UseCRISPR and Synthetic BiologyMutationS. pyogenes dCas9 codon optimized for Streptomyce…PromoterSP30Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide_CjCas9-Puro
Plasmid#202564PurposehU6-BsmBI-gRNA-PuroDepositorInsertCjCas9 sgRNA cassette
ExpressionMammalianPromoterhU6Available SinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_Puro_sgAAVS1
Plasmid#187818PurposepLentiCRISPR that is selectable with puromycin with an sgRNA targeting AAVS1DepositorInsertsgAAVS1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTJV1Sc-rpoB
Plasmid#166978PurposeGenerates ssDNA in vivo targeting E. coli rpoB for recombineering w/ Beta recombinase; temp. sensitive pSC101 ori and sgRNA for Cas9 counterselection; aada for spectinomycin resistanceDepositorInsertsUseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23101 and VanCCAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-V2_mMSH2
Plasmid#186156PurposesgRNA targeting murine Msh2 geneDepositorAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSET-dCas9-actII-4-NT-S1
Plasmid#110185PurposeRepression of gene expression in Streptomyces by CRISPRiDepositorInsertsdCas9
sgRNA
UseCRISPR; IExpressionBacterialMutationD10A, H840APromoterJ23119 and ermE*pAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide_mCherry_NT135
Plasmid#183121PurposepLentiGuide modified to express mCherry and a non-targeting sgRNADepositorInsertNT135
UseLentiviralPromoterU6Available SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSA-ARS-CRISPR-BlastR
Plasmid#101009PurposeExpresses Cas9-Nlux and sgRNA and contains CEN/ARS. CCMP537 LDSP promoter driven Blasticidin resistance gene.DepositorTypeEmpty backboneUseAlgae, nannochloropsisAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT03
Plasmid#223375PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide_mCherry_sgEPAS1#1
Plasmid#183122PurposepLentiGuide modified to express mCherry and an sgRNA targeting EPAS1DepositorInsertsgEPAS1-1
UseLentiviralPromoterU6Available SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC-CRISPR-P2A-BlastR
Plasmid#98147PurposeExpresses Cas9-Nlux-P2A-BlastR and sgRNA in Nannochloropsis oceanica.DepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsP2A-BlastR fusion with Cas9-NluxPromoterRibi promoterAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas34
Plasmid#82386PurposesgRNA targeting YFP expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
doraWT_rescue_construct
Plasmid#190609PurposePuromycin-selectable expression of Dora (CG34401) in Drosophila S2 cellsDepositorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiUniversal-Puro
Plasmid#127749PurposeLentiviral plasmid for expressing any U6 driven transcripts (sgRNAs, crRNAs, shRNAs and etc...)DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_1-MS2-Puro
Plasmid#192673PurposeLentiviral expression of sgRNA targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNA #1 (MYOD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLQ-KO-tgt50
Plasmid#126578PurposeCRISPR-Cas9 based efficient genome editing in S. aureusDepositorInsertCas9-Pxyltet-sgRNA-Pspac-donor-tgt50
UseCRISPRExpressionBacterialAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUB-Cas9-@GL1
Plasmid#86779PurposeDisruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9DepositorInsertsgRNA against GLABROUS1
UseSynthetic BiologyExpressionPlantPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUF-AsCpf1-pre-gRNA
Plasmid#137849PurposeAsCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertAsCpf1 and pre-gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUF-LbCpf1-pre-gRNA
Plasmid#137848PurposeLbCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertLbCpf1-NLS-FLAG and gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.dTomato
Plasmid#89392PurposeLentiviral CRISPR-Cas9 delivery for sgRNA (hU6), dTomato coexpression, EFS Promoter drivenDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-phaZ
Plasmid#169874PurposeSingle guide RNA plasmid for Cas9 targeting phaZ in P. putidaDepositorInsertsgRNA towards phaZ in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNAkan-glpR
Plasmid#169873PurposeSingle guide RNA plasmid for Cas9 targeting glpR in P. putidaDepositorInsertsgRNA towards glpR in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-mir144 EF1Alpha-puro-T2A-BFP
Plasmid#164791PurposeExpress miR-144 under the U6 promoter in mammalian cellsDepositorInsertsUseLentiviralExpressionMammalianPromoterEF1Alpha and U6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
KA2601_eSpCas9-G2P
Plasmid#124203PurposeExpression of eSpCas9(1.1) and sgRNADepositorTypeEmpty backboneExpressionMammalianAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG_GI4
Plasmid#111595PurposeGI Library VectorDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC-CRISPR
Plasmid#100008PurposeExpresses Cas9-Nlux and sgRNA in Nannochloropsis oceanica, contains hygromycin resistance cassette, for integration into genomeDepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsCas9-NluxPromoterRibi promoterAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lsg-LRRK2-1
Plasmid#199277Purposenicking sgRNA to induce LRRK2 (c. 6055 G > A) mutation using PE3DepositorInsertLRRK2 nick
ExpressionMammalianAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.PAC
Plasmid#89393PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), PAC (Puromycin resistance) coexpression, EFS Promoter drivenDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hNEUROD1 gRNA_1-MS2-Puro
Plasmid#192676PurposeLentiviral expression of sgRNA targeting hNEUROD1 promoter to activate human NEUROD1 transcriptionDepositorInsertHuman NEUROD1 activating gRNA #1 (NEUROD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide_GFP_sgEPAS1#1
Plasmid#183119PurposepLentiGuide modified to express GFP and an sgRNa targeting EPAS1DepositorInsertsgEPAS1-1
UseLentiviralPromoterU6Available SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_TOP1
Plasmid#68423PurposeTransient expression of the "TOP1" construct, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertTOP1 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato90/816
Plasmid#179918PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only