We narrowed to 18,888 results for: REV

#234801

Mammalian expression of bovine arrestin-3 (K11A, K12A, L49A, D51A, R52A, L69A, Y239A, D241A, C252A, P253A, D260A, Q262A)

Vsevolod Gurevich

Breitman et al J Biol Chem. 2012 Jun 1;287(23):19653-64

April 23, 2025

Academic Institutions and Nonprofits only

#232739

Expresses NADPH/NADP+ biosensor NAPstar2 in S. cerevisiae.

Bruce Morgan

Scherschel et al Nat Commun. 2024 Dec 19;15(1):10704. doi

April 4, 2025

Academic Institutions and Nonprofits only

#232741

Expresses NADPH/NADP+ biosensor NAPstar4 in S. cerevisiae.

Bruce Morgan

Scherschel et al Nat Commun. 2024 Dec 19;15(1):10704. doi

April 4, 2025

Academic Institutions and Nonprofits only

#232742

Expresses NADPH/NADP+ biosensor NAPstar6 in S. cerevisiae.

Bruce Morgan

Scherschel et al Nat Commun. 2024 Dec 19;15(1):10704. doi

April 4, 2025

Academic Institutions and Nonprofits only

#232744

Expresses NADPH/NADP+ biosensor NAPstar7 in S. cerevisiae.

Bruce Morgan

Scherschel et al Nat Commun. 2024 Dec 19;15(1):10704. doi

April 4, 2025

Academic Institutions and Nonprofits only

#217439

HIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q63A,Q67A mutations in CA).

Jarrod Johnson

Scott et al PLoS Pathog. 2025 Jan 28;21(1):e1012206.

Jan. 28, 2025

Academic Institutions and Nonprofits only

#217441

HIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef. Contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q67H,N74D mutations in CA).

Jarrod Johnson

Scott et al PLoS Pathog. 2025 Jan 28;21(1):e1012206.

Jan. 28, 2025

Academic Institutions and Nonprofits only

#87390

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87388

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87389

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only