We narrowed to 5,521 results for: crispr cas9 grna plasmid
-
Plasmid#241724PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains BSD marker for selection on blasticidin SDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pBHM2678
Plasmid#241723PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains BLE marker for selection on phleomycinDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2680
Plasmid#241725PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains BSR marker for selection on blasticidin SDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_835
Plasmid#245327PurposeCas9 CRISPRko positive control guide; targets CD59DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
KO plasmid
Plasmid#135970PurposeExpresses SpCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneExpressionMammalianAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSGAb-km
Plasmid#121999PurposeA sgRNA expression plasmid for genome editing in Acinetobacter baumanniiDepositorInsertnone
UseCRISPRAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSGAb-spe
Plasmid#122000PurposeA sgRNA expression plasmid for genome editing in Acinetobacter baumanniiDepositorInsertnone
UseCRISPRAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P4 TaU6 guide acceptor
Plasmid#165600PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P3 TaU6 guide acceptor
Plasmid#165599PurposeGoldenGate (MoClo) Level 1 Position 3 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Wei lab paired-guide RNA (pgRNA) CRISPR–Cas9 library for human long non-coding RNAs (lncRNAs)
Pooled Library#89640PurposeDesigned for genomic deletion screening of functional lncRNAs (long non-coding RNAs) using lentiviral pgRNAs (paired-guide RNAs).DepositorExpressionMammalianUseLentiviralAvailable SinceMay 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-Stuffer
Plasmid#106248PurposeDestination vector for U6::gRNA expression cassetteDepositorTypeEmpty backboneUseAAVAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Pers
Plasmid#168281PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgPer1-3-hU6-sgPer2-1-hU6-sgPer2-2
UseAAVTagsmCherryPromoterU6, hSynAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV ORANGE Dlg4-HaloTag KI
Plasmid#139656PurposeEndogenous tagging of PSD95: C-terminal (amino acid position: R721)DepositorInsertgRNA and HaloTag donor
UseAAVExpressionMammalianPromoterU6Available SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV ORANGE Gria1-HaloTag KI
Plasmid#139655PurposeEndogenous tagging of GluA1: C-terminal (amino acid position: STOP codon)DepositorInsertgRNA and HaloTag donor
UseAAVExpressionMammalianPromoterU6Available SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDD428
Plasmid#202081PurposeCas9/sgRNA plasmid targeting the C-terminus of Myh9DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVT36b
Plasmid#184437PurposeCRISPR/Cas9 plasmid, containing ScARS, IoURA3, iCas9, RPR1’-tRNA_Leu promoter, and sgRNA scaffoldDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6-spTRE3G-CMV-mTagBFP2
Plasmid#102854PurposeA plasmid encoding TRE3G sgRNA (for SpCas9) and mTagBFPDepositorInsertsp-TRE3G-sgRNA; mTagBFP2
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP2283
Plasmid#70702PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2266
Plasmid#70705PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cloning template vector
Plasmid#131471PurposeCloning template form ORANGE method based knock-in constructsDepositorTypeEmpty backboneTagsHAExpressionMammalianPromoterU6 and CbhAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
BPK2101
Plasmid#65770PurposeBacterial expression plasmid for S. aureus Cas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSaCas9-NLS-3xFLAG-T7-BsaIcassette-Sa-sgRNADepositorInsertmammalian codon-optimized SaCas9, and SaCas9 gRNA
UseCRISPRTagsNLS-3xFlagExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP712
Plasmid#65768PurposeBacterial expression plasmid for Sp-dCas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSpdCas9(D10A/H840A)-T7-BsaIcassette-Sp-sgRNADepositorInsertmammalian codon-optimized Streptococcus pyogenes dCas9 (D10A/H840A)-NLS-3XFlag, and SpCas9 gRNA
UseCRISPRTags3x FLAG and NLSExpressionBacterialMutationD10A and H840A mutations in Cas9PromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-RGR-r10
Plasmid#74370PurposeThis plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r10
UseCRISPR and Synthetic BiologyExpressionYeastPromoterADH1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only