We narrowed to 4,099 results for: biorxiv
-
Plasmid#228577PurposeExpresses mouse TMEM16F-I521A-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521A plus a 3 amino acid N-terminal truncation (…Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TMEM16F-I521E-peGFP-N1
Plasmid#228578PurposeExpresses mouse TMEM16F-I521E-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521E plus a 3 amino acid N-terminal truncation (…Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK Promoter (MTK 2) (pAN2822)
Plasmid#194224PurposeMammalian Toolkit part 2 encoding the PGK promoterDepositorInsertPGK Promoter
UseSynthetic BiologyPromoterPGKAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a Promoter (MTK 2) (pAN2824)
Plasmid#194225PurposeMammalian Toolkit part 2 containing the EF1a promoterDepositorInsertEF1a Promoter
UseSynthetic BiologyPromoterEF1aAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1301-AAV-EFSNC-dCjCas9-NIPP1(143-224)
Plasmid#223146PurposeExpression of truncated NIPP1 with dCjCas9 and empty gRNA scaffoldDepositorInsertNIPP1 (PPP1R8 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 143-224PromoterEF1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1311-AAV-EFSNC-dSaCas9-NIPP1(143-224)
Plasmid#223156PurposeExpression of truncated NIPP1 with dSaCas9 and empty gRNA scaffoldDepositorInsertNIPP1 (PPP1R8 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 143-224PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm1
Plasmid#222911PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 1 (NPM2 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm4
Plasmid#222914PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 4 (NPM2 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm3
Plasmid#222913PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 3 (NPM2 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_TFAP2C-T2A-mGreenLantern-Hygro
Plasmid#222915PurposeHomology directed repair template for knocking in mGreenLantern reporter to TFAP2C.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm2
Plasmid#222912PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 2 (NPM2 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1_oROS-HT_LF(C199S)
Plasmid#216412PurposeExpresses the loss-of-function mutation C199S of the genetically encoded, chemigenetic hydrogen peroxide sensor oROS-HT in mamalian cells.DepositorInsertoROS-HT_LF(C199S)
ExpressionMammalianPromoterCMVAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1-lifeact-oROS-HT
Plasmid#216420PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to actin filaments.DepositorInsertlifeact-oROS-HT
ExpressionMammalianPromoterCMVAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxEXPr6
Plasmid#218290PurposeIntroduction of a cyanamide-inducible I-SceI expression cassette and a TetR-TUP1 expression cassette, use together with pJQR3DepositorInserthph>tCYC1-ISceI.site-Repeat2-pDDI2>ISceI>tSynth3-pHAC1>TetR>TUP1>tABF1-HO(182,1979)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJQR3
Plasmid#218289PurposeIntroduction of a Zif268-hER-VP16 expression cassette and a LmrA-Mig1C expression cassette, use together with pToxEXPR6DepositorInsertHO(-253,-1)-pADH1>LmrA>MIG1(aa123-504)>tMIG1-tYGL036WExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pITEdv1
Plasmid#218283PurposeUse together with with pJE13HD7 and pJE13HD7 derivatives to integrate heterologous genes at ho locusDepositorInsertHph>tAgTEF1-ISceI-Repeat1-HO(1828, 1979)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pITEu2
Plasmid#218282PurposeUse together with pToxEXP/pToxAmp plasmids to insert heterologous genes at ho locusDepositorInsertHO(-253, -1)-Repeat2-ISceI-pAgTEF1>Hph(partial)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJE13HD7
Plasmid#218281PurposeUse together with pITEdv1, or pToxEXP1/pToxAmp plasmids to insert heterologous gene(s) at ho locus.DepositorInsertHO(-253, -1)-Repeat1-ISceI-pAgTEF1>Hph(partial)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only