We narrowed to 11,444 results for: AGA
-
Plasmid#211682PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-42 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pED7x26
Plasmid#134813PurposeStringent phage propagation reporter containing pIII-16-29-34-TAGADepositorInsertpIII 16-TAGA 29-TAGA 34-TAGA
UseSynthetic BiologyExpressionBacterialMutation16-TAGA 29-TAGA 34-TAGAAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK01_Rho_minprox_DsREd
Plasmid#173489PurposePCR template for reporter gene with mouse Rhodopsin promoter with DsRedDepositorInsertMouse Rhodopsin promoter driving DsRed reporter gene
ExpressionMammalianPromoterMouse RhodopsinAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn1-iCre-P2A-mRuby3
Plasmid#235248PurposeAAV-mediated expression of iCre and mRuby3 in mammalian cellsDepositorInsertsiCre
mRuby3
UseAAV and Cre/LoxExpressionMammalianPromoterhsyn1Available SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-jGCaMP8m-P2A-CyRFP1-WPRE
Plasmid#235249PurposeAAV-mediated and Cre-dependent expression of jGCaMP8m and CyRFP1 in mammalian cellsDepositorInsertsjGCaMP8m
CyRFP1
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Setd1a gRNA#1
Plasmid#235250PurposeCas9-mediated knockout of Setd1a in mammalian cellsDepositorAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
Setd1a gRNA#2
Plasmid#235251PurposeCas9-mediated knockout of Setd1a in mammalian cellsDepositorAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
Setd1a gRNA#3
Plasmid#235252PurposeCas9-mediated knockout of Setd1a in mammalian cellsDepositorAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PDGFRb-IRES2-EGFP
Plasmid#204354PurposeExpresses wild-type PDGFRb gene.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1050K (firefly luciferase)
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-PDGFRb-HA
Plasmid#204350PurposeExpresses wild-type PDGFRb gene. Used for DNA delivery using Adeno-associated Virus.DepositorAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PDGFRb559-562del-IRES2-EGFP
Plasmid#204355PurposeExpresses a mutant PDGFRb gene (559-562 deletion).DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
Mutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-PDGFRb559-562del-HA
Plasmid#204351PurposeExpresses a mutant PDGFRb gene (559-562 deletion). Used for DNA delivery using Adeno-associated Virus.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
UseAAVTagsHAMutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSERT-1.9k-Venus-WPRE
Plasmid#156394PurposeExpresses Venus under SERT gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfCCK-0.5k-Venus-WPRE
Plasmid#156392PurposeExpresses Venus under CCK gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSST-0.3k-Venus-WPRE
Plasmid#156393PurposeExpresses Venus under SST gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfPENK-0.9k-Venus-WPRE
Plasmid#156401PurposeExpresses Venus under PENK gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.643
Plasmid#105565Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only