We narrowed to 2,589 results for: GCG
-
Plasmid#96852PurposeHHR-bsgRNA-GFP (13 nt blocker)DepositorInsertHHR-bsgRNA-GFP (13 nt blocker)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT016b
Plasmid#96853PurposedHHR-bsgRNA-GFP (13 nt blocker)DepositorInsertdHHR-bsgRNA-GFP (13 nt blocker)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN10-gDM1d
Plasmid#114387PurposepPN10 with gRNA for spCRISPR-Cas9 against the 3' UTR of the DMPK gene target: TGCGAACCAACGATAGGTG PAM: GGGDepositorInsertgDM1d
UseCRISPRAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgSlc32a1
Plasmid#159905PurposeMutagenesis of Slc32a1DepositorInsertSlc32a1 (Slc32a1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRi-D2
Plasmid#182927Purposeinducible CRISPRi plasmid with gRNA targeting to psbD gene in Synechocystis 6803DepositorInsertddcpf1
UseCRISPRAvailable SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUCSh5vio-2300
Plasmid#170987PurposeEncodes sgRNA target 2300 and Gentamicin resistance - violacein pathway transposon.DepositorInsertSh-CAST sgRNA 2300 violacein
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterplacIAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro PRMT5-CRISPRi
Plasmid#164637PurposelentiGuide-Puro backbone with cloned target sequence for human PRMT5. The insert is: 5´- CACCGAGCCGCGTGTCCAGCGGGA-3. sgRNA achieves a downregulation of PRMT5 in combination with dCAS9-KRAB-MCP2DepositorInserttarget guide sequence PRMT5 inhibition (PRMT5 Human)
UseCRISPR and Lentiviral; InterferenceExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPB_1
Plasmid#64036PurposeExpresses gRNA against human CEBPB along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRPromoterU6Available SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-L3US2-RFP-HDAC3
Plasmid#83966PurposeLentiviral CRISPR HDAC3 dual gRNA targeting vectorDepositorAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA5
Plasmid#100557PurposeExpresses MYC sgRNA5. Target sequence GAGAGGCAGAGGGAGCGAGCDepositorInsertMYC sgRNA5
PromoterU6Available SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA4
Plasmid#100556PurposeExpresses MYC sgRNA4. Target sequence: GTAATTCCAGCGAGAGGCAGDepositorInsertMYC sgRNA4
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUCSh2-2300
Plasmid#170984PurposeEncodes sgRNA target 2300 and Kanamycin resistance transposon.DepositorInsertSh-CAST sgRNA 2300
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCSh3-2300
Plasmid#170985PurposeEncodes sgRNA target 2300 and Tetracycline resistance transposon.DepositorInsertSh-CAST sgRNA 2300
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWT049d
Plasmid#96862Purposeguanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsertguanine-agRNA (19 nt blocker with bulges, RFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049e
Plasmid#96863Purpose(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsert(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA-ctrl
Plasmid#85741PurposeshRNA ctrlDepositorInsertshRNA ctrl
UseAAVTagsEYFPAvailable SinceApril 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPM sh2 DNMT1
Plasmid#88885PurposeLentiviral vector expressing shRNA against murine DNMT1DepositorInsertshRNA no.2 DNMT1
UseLentiviralExpressionMammalianPromoterSFFV (spleen focus forming virus)Available SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPM sh1 DNMT1
Plasmid#88884PurposeLentiviral vector expressing shRNA against murine DNMT1DepositorInsertshRNA no.1 DNMT1
UseLentiviralExpressionMammalianPromoterSFFV (spleen focus forming virus)Available SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-L1221
Plasmid#101335Purposenegative control for knockdowns target site: CTTGTCGATGAGAGCGTTTGTDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only