We narrowed to 377 results for: iRFP670
-
Plasmid#169638PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a iRFP670 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-iRFP670-p2A-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven iRFP670 and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A TagRFP-T P2A puro
Plasmid#122200PurposeThe plasmid codes for a Flag-spCas9 protein, a TagRFP-T fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsspCas9
TagRFP-T
UseLentiviralTagsT2AExpressionMammalianAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A mNeonGreen P2A puro
Plasmid#122183PurposeThe plasmid codes for a Flag-spCas9 protein, a mNeonGreen fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
LiOn-CAG∞IRFP
Plasmid#154017PurposeVector based on the LiOn integration-coupled translational switch (Kumamoto et al bioRxiv 2019) expressing the fluorescent protein IRFP670 from a CAG promoter upon action of the piggyBac transposaseDepositorInsertIRFP670
ExpressionMammalianPromoterCAGAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTS2163
Plasmid#169632PurposeTier-3 vector for CRISPR-mediated stable integration into the AAVS1 locus of the tetON-system (OTetO7-PCMVmin-SEAP-p2A-iRFP670-pA::PmPGK1-rtTA-pA::A3-pA)DepositorInsertOTetO7-PCMVmin-SEAP-iRFP670::PmPGK1-rtTA-pA::A3
ExpressionMammalianPromotertetO7-PhCMVmin / PPGKAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1039
Plasmid#169617PurposeTier-2 vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP
ExpressionMammalianPromoterPhCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTK3b_005
Plasmid#123786PurposeEncodes iRFP670 as a Type 3b part to be used in the MTK systemDepositorInsertiRFP670
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVH666
Plasmid#169610PurposeTier-2 vector encoding PTtgO2-driven SEAP-p2A-iRFP670, PmPGK1-driven TtgA and PmPGK1-driven mRuby2 expression (PTtgO2-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-TtgA-pA::PmPGK1-mRuby2-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven TtgA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH664
Plasmid#169608PurposeTier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven rtTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-rtTA-pA::PmPGK1-YPet-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven rtTA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH663
Plasmid#169607PurposeTier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven tTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-tTA-pA::PmPGK1-YPet-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven tTA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTK4a_011
Plasmid#123824PurposeEncodes a nuclear localized iRFP670 coexpression cassette as a Type 4a part to be used in the MTK systemDepositorInsertT2A::NLS::iRFP670
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTS1043
Plasmid#169621PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::PPGK-IgkSS-Nluc-p2A-mTagBFP2-pA) .DepositorInsertPCMV-driven expression of SEAP and iRFP and PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1042
Plasmid#169620PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (PhCMV-SEAP-p2A-iRFP670-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTS2326
Plasmid#169628PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (PhCMV-SEAP-p2A-iRFP670-pA::pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and pGL3-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2321
Plasmid#169626PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and CoTC-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2329
Plasmid#169629PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 preluded by a 5' spacer sequence (PhCMV-SEAP-p2A-iRFP670-pA::spacer-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and spacer-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only