We narrowed to 1,897 results for: sfGFP
-
Plasmid#189674Purposetitratable expression of sfGFP in bacteriaDepositorInsertsfGFP
TagsHis-T7-EKExpressionBacterialPromoterpBADAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTBL3328 PB-sfGFP-WPRE-target
Plasmid#226676PurposePiggyBac cargo vector encoding sfGFP followed by WPRE and a transcribed peCHYRON target site.DepositorInsertsfGFP-WPRE-site3target
ExpressionMammalianPromoterEF1alphaAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-sfGFP
Plasmid#184226PurposeExpresses SpyTag-superfolder GFP in the bacterial cytoplasm. SpyTag enables covalent reaction with SpyCatcher.DepositorInsertSpyTag-sfGFP
TagsHis6, SpyTag, and TEV protease cleavage siteExpressionBacterialPromoterT5Available SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pXJ520-pAAV-PB3'IR-CAG-MCP-GFP-KASH-6XMS2-hU6-gRNA-PB5'IR
Plasmid#254955PurposeAAV piggyBac vector with single gRNA and CAG-driven MCP-sfGFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertMCP-sfGFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXJ521-pAAV-PB3'IR-CAG-PCP-GFP-KASH-6XPP7-hU6-gRNA-PB5'IR
Plasmid#254956PurposeAAV piggyBac vector with single gRNA and CAG-driven PCP-sfGFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertPCP-sfGFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXJ496-pAAV-PB3'IR-CAG-PCP-GFP-KASH-6XPP7-dual sgRNA-PB5'IR
Plasmid#254950PurposeAAV piggyBac vector with dual gRNAs and CAG-driven PCP-sfGFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertPCP-sfGFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pME_G_E_007_UAV_sfGFP_PaqCI
Plasmid#235975PurposeUniversal acceptor vector with sfGFP placeholder PaqCI compatible for lvl0 assemblyDepositorInsertUAV_sfGFP_PaqCI
UseSynthetic BiologyAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-sfGFP-G418
Plasmid#236481PurposePlasmid for deleting or C-terminally tagging endogenous genes with sfGFP and selection on G418.DepositorInsertsfGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-sfGFP-GSAx9-iCre-ERT2
Plasmid#125748PurposesfGFP and iCreERT2 fused by GSAx9 linkerDepositorInsertsfGFP-GSAx9-iCre-ERT2
UseCre/LoxExpressionMammalianAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 150TAG
Plasmid#154772Purposeplasmid with 4xhybrid PylT cassette (Mx1201 G1 PylT hybrid mutant A41AA C55A) and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in GFP reporter, hybrid PylT with A41AA an…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-pT3-tetR-sfGFP
Plasmid#140871PurposeT3 promoter driven synthesis of TetR-sfGFPDepositorInsertTetR-sfGFP expressed with T3 promoter
UseSynthetic BiologyTagssfGFPExpressionBacterialPromoterT3Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xG1 PylT sfGFP 150TAG
Plasmid#154767Purposeplasmid with 4xG1 PylT cassette and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAGPromoterEF1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWN172
Plasmid#215291PurposeExpresses sfGFP under the Anderson J23113 promoter with an RSF1010 backbone.DepositorInsertsfGFP
TagsHisExpressionBacterialPromoterJ23113Available SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD_D-AtUBI10-NbGP41-sfGFP-VP64-GB1
Plasmid#202012PurposeMoclo level 1 - Module D, Promoter: AtUBI10, Gene: NbGP41P-sfGFP-VP64-GB1, Terminator: pea rbcsE9DepositorInsertNbGP41-sfGFP-VP64-GB1
UseSynthetic Biology; Moclo level 1 vectorTagsGB1 and sfGFPPromoterAtUBI10Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
H2B-sfGFP-T2A-iCre
Plasmid#178546PurposepCMV-Histone H2B-sfGFP-T2A-iCre-bpA-FRT-Neo*-FRTDepositorInsertHistone H2B-sfGFP-T2A-iCre
UseCre/Lox and Mouse Targeting; Flp/frtExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVY-3 sfGFP-tag3
Plasmid#194618Purposefluorescent proteins with cationic peptide tags to promote biomolecular condensate formation in E. coliDepositorInsertsfGFP-K(GGSKKRKKR)3
TagsKGGSKKRKKRGGSKKRKKRGGSKKRKKR and MGHHHHHGGAExpressionBacterialPromoterT7Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 102TAG 150TAA
Plasmid#154776Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and dual suppression reporter sfGFP 102TAG 150 TAA stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation102TAG 150TAA in GFP reporter, hybrid PylT with A…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 102TAA 150TAG
Plasmid#154777Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and dual suppression reporter sfGFP 102TAA 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation102TAA 150TAG in GFP reporter, hybrid PylT with …PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only