We narrowed to 3,890 results for: 28
-
Plasmid#188231PurposePolycistronic human LIN28 and NANOG were cloned into the pMXs vectorDepositorUseRetroviralExpressionMammalianAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pN1 VAMP2 R125TAG
Plasmid#69877Purposeexpress in mammalian cells for unnatural amino acid incorporation into VAMP2DepositorInsertVAMP2 (Vamp2 Rat)
UseSynthetic BiologyExpressionMammalianMutationAmber and Ochre stop codons in the former linker …Available SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
[pSK497] pLJC5 Flag-Depdc5(AB)
Plasmid#109341PurposeLenti-viral expression of Flag-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsFLAGMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-cGAS R71/75E C396/7A-HA
Plasmid#130920PurposeExpresses human cGAS with R71/75E and C396/397A point mutations; Puromycin selection markerDepositorInserthuman cGAS R71/75E C396/7A
TagsHAExpressionMammalianMutationaa 71 and 75 mutated to glutamate; aa 396 and 397…PromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-full length mSesn2 (FL: A+B+C)
Plasmid#111796PurposeMammalian Expression of mSesn2DepositorAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZS1[FruR-T,LacI-T]
Plasmid#60768PurposeContains PIq driving expression FruR-T, and PI driving expression of LacI-T.DepositorInsertsFruR-T
Dimeric LacI with the TAN DBD
UseSynthetic BiologyExpressionBacterialMutationDimeric LacI with the TAN DBD. and LacI/GalR repr…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-T,RbsR-T]
Plasmid#60773PurposeContains PIq driving expression GalS-T, and PIq driving expression of RbsR-T.DepositorInsertsGalS-T
GalS-T
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. TAN DBD with GalS LB…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA8-Flag-LARS(1-360aa)
Plasmid#139668PurposeExpresses N-teminal Flag tagged aa 1-360 of LARS1 proteinDepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-T,TreR-T]
Plasmid#60775PurposeContains PIq driving expression GalS-T, and PI driving expression of TreR-T.DepositorInsertsGalS-T
TreR-T
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. TAN DBD with GalS LB…Available SinceMay 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[FruR-T,TreR-T]
Plasmid#60772PurposeContains PIq driving expression FruR-T, and PIq driving expression of TreR-T.DepositorInsertsFruR-T
TreR-T
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. TAN DBD with FruR LB…Available SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[RbsR-T,TreR-T]
Plasmid#60776PurposeContains PIq driving expression RbsR-T, and PI driving expression of TreR-T.DepositorInsertsRbsR-L
TreR-T
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. TAN DBD with RbsR LB…Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[RbsR-T,LacI-T]
Plasmid#60767PurposeContains PIq driving expression RbsR-T, and PI driving expression of TreR-L.DepositorInsertsRbsR-L
Dimeric LacI with the TAN DBD
UseSynthetic BiologyExpressionBacterialMutationDimeric LacI with the TAN DBD. and LacI/GalR repr…Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-Pgc-1alpha-EYFP
Plasmid#241793PurposeExpression vector for mouse Pgc-1alpha with EYFPDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEK42
Plasmid#214958PurposeEndogenous tagging of B. dendrobatidis GAPDH with a red fluorescent protein, hygromycin B selectionDepositorInsertsBdGAPDH_LHA2-G4S-HsmRuby3-ScADH1ter
SpH2Bpro-Hshph-BdGAPDH_RHA2
UseBd gene targeting vectorExpressionBacterialPromoterSpH2BproAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEK48
Plasmid#214964PurposeEndogenous tagging of B. dendrobatidis Myo17D with a red fluorescent protein, hygromycin B selectionDepositorInsertsBdMyo17D_LHA-G4S-HsmRuby3-ScADH1ter
SpH2Bpro-Hshph-BdMyo17D_RHA
UseBd gene targeting vectorExpressionBacterialPromoterSpH2BproAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_mouseH3.1
Plasmid#244241PurposeExpresses SpCas9 and a sgRNA targeting the mouse histone H3.1 loci for knock-in.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only