We narrowed to 7,413 results for: ESP
-
Plasmid#91059PurposeModule B, Promoter: none (begins with P2A to be fused to TALEN_1), Gene: TALEN_2 backbone with Esp3I ccdb cassette for repeat cloning, Terminator: HSPDepositorInsertTALEN_2 backbone with Esp3I ccdb cassette for repeat cloning
UseTALENPromoternone (begins with P2A to be fused to TALEN_1)Available SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
R777-E360 Hs.YAP1-nostop
Plasmid#70644PurposeGateway ORF clone of human YAP1 [NM_001130145.2] without stop codon (for C-terminal fusions)DepositorInsertYAP1 (YAP1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E296 Hs.RPS6KA6-nostop
Plasmid#70580PurposeGateway ORF clone of human RPS6KA6 [NM_014496.4] without stop codon (for C-terminal fusions)DepositorInsertRPS6KA6 (RPS6KA6 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E262 Hs.RASSF5-nostop
Plasmid#70546PurposeGateway ORF clone of human RASSF5 [NM_182665.3] without stop codon (for C-terminal fusions)DepositorInsertRASSF5 (RASSF5 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E181 Hs.PIK3R6
Plasmid#70465PurposeGateway ORF clone of human PIK3R6 [NM_001010855.3] with stop codon (for native or N-terminal fusions)DepositorInsertPIK3R6 (PIK3R6 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E202 Hs.PRKAG2-nostop
Plasmid#70486PurposeGateway ORF clone of human PRKAG2 [NM_024429.1] without stop codon (for C-terminal fusions)DepositorInsertPRKAG2 (PRKAG2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E124 Hs.MAP2K2-nostop
Plasmid#70408PurposeGateway ORF clone of human MAP2K2 [NM_030662.3] without stop codon (for C-terminal fusions)DepositorInsertMAP2K2 (MAP2K2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PSUC2-GFPantisense-CYC1t-pRS413
Plasmid#64404PurposeSUC2 regulated expression of an antisense RNAi construct for GFPDepositorInsertGFPantisense
ExpressionYeastPromoterSUC2Available SinceJune 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAG78 3'UTR
Plasmid#12023DepositorInsertN2 3'UTR
UseLuciferaseExpressionMammalianAvailable SinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAG84 3'UTR
Plasmid#12026DepositorInsertN5 3'UTR
UseLuciferaseExpressionMammalianAvailable SinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET30a-PmPPA-ET64
Plasmid#234667PurposeExpression an ELP-tagged PmPPA enzymeDepositorInsertpyrophosphatase
TagsELPExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pET28aAviHisCD72cCTLD
Plasmid#129066Purposegeneration of biotinylated mouse CD72c CTLD protein using bacteriaDepositorInsertCD72c (Cd72 Mouse)
ExpressionBacterialAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC314-P4H3
Plasmid#203155PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC314DepositorInsertEGFP/BC314
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY1935
Plasmid#212315PurposeExpress ApmFnuc protein with sumotagDepositorInsertIsvmimi
Tags6xHis-thrombin site-TwinStrepTag-SUMOExpressionBacterialAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC2-P1A2
Plasmid#202843PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC2DepositorInsertEGFP/BC2
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only