We narrowed to 16,804 results for: OMP;
-
Plasmid#72909PurposeGFP-tagged mSin1 (isoform 5)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTarget of rapamycin complex 2 subunit MAPKAP1, isoform 5 (MAPKAP1 Human)
TagseGFPExpressionMammalianAvailable sinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-Venus-MDGA1
Plasmid#82543PurposeOverexpression vector for Venus-MDGA1 in neuronsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMDGA1 (MDGA1 Human)
TagsVenus fluorescent proteinExpressionMammalianPromoterchicken beta actinAvailable sinceSept. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV-myrAkt
Plasmid#49267Purposeretroviral expression of Bovine Akt with the NH2-terminal myristylation-palmitylation signal sequenceDepositorPublicationInsertAkt (AKT1 Bovine)
UseRetroviralTagsIRES-EGFP and myrExpressionMammalianMutationN2D, D149E and A478G compared to AAW71957.1Available sinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET12a-AL-09 FL
Plasmid#47081DepositorAvailable sinceAug. 1, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M10.2-IRES-tauVenus-ACNF Targeting Vector
Plasmid#15858DepositorInsertM10.2
ExpressionBacterialAvailable sinceMay 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Cep131
Plasmid#136826PurposeMammalian expression of the centrosomal protein Cep131 N-terminally fused to SNAP-tagDepositorInsertSNAP-Cep131 (CEP131 Synthetic, Human)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available sinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-INTS3-FL
Plasmid#128415PurposeExpress INTS3 full-length in E. coli with a GST tag (N-terminal)DepositorAvailable sinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-N3/hArf6(WT)-EGFP
Plasmid#79423PurposeExpresses C-terminally EGFP-tagged Arf6(WT) in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertArf6 (ARF6 Human)
TagsEGFPExpressionMammalianAvailable sinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pILGFPI7
Plasmid#83555PurposeUsed to evaluate the expression output of CUP1 promoter with yEGFP used as the reporter gene.DepositorInsertCUP1 promoter-yEGFP
ExpressionYeastPromoterCUP1Available sinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
mChF-AIP
Plasmid#61527PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP and mCherryExpressionMammalianPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
GST-PRDM16 1039-1176
Plasmid#53351Purposebacterial expression of mouse PRDM16 fragmentDepositorAvailable sinceJune 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
GST-PRDM16 681-880
Plasmid#53349Purposebacterial expression of mouse PRDM16 fragmentDepositorAvailable sinceJune 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
GST-PRDM16 455-680
Plasmid#53348Purposebacterial expression of mouse PRDM16 fragmentDepositorAvailable sinceJune 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-APC11
Plasmid#19900DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAPC11 (Anaphase promoting complex subunit 11) (ANAPC11 Human)
TagsHAExpressionMammalianAvailable sinceApril 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
ATG9A-EGFP
Plasmid#210367PurposeExpresses ATG9A fused with EGFP in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATG9A (ATG9A Human)
TagsEGFPExpressionMammalianAvailable sinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBpaRS3tRNA
Plasmid#197102PurposeTo express the p-benzoylphenylalanine-specific variant of Methanocaldococcus jannaschii TyrRS and its cognate amber suppressor tRNA and allow UAG codon to be translated into p-benzoylphenylalanine.DepositorInsertTyrRS variant, amber suppressor tRNA
ExpressionBacterialMutationGly32, Ser107, Thr158, Ser159, Arg286 (TyrRS)Available sinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
opto-Cdc42
Plasmid#174510PurposeExpresses opto-Cdc42 (mCherry-GGGSx2-Cdc42-GGGSx2-BcLOV4-GGGS-3xFLAG) in a pcDNA3.1 backbone.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertopto-Cdc42-mCherry
Tags3xFLAG and mCherryExpressionMammalianPromoterCMVAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 ORF10wu
Plasmid#149332PurposeGateway-compatible Entry vector, with insert of ORF10wu gene's CDS from SARS-CoV-2 genome definition in Wu et al, Nature 2020DepositorInsertORF10wu (ORF10 SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable sinceMay 27, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 NSP2_nostop
Plasmid#149305PurposeGateway-compatible Entry vector, with insert of NSP2 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1. Does not contain stop codon.DepositorInsertNSP2 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable sinceMay 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits