We narrowed to 23,440 results for: Cas9
-
Plasmid#110855PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-PGK-Puro
Plasmid#110856PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-GFP-PGK-Puro
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
SUPERBLADE5
Plasmid#134913PurposeEmpty backbone for cloning sgRNA sequence to be used in nanoblades system (Optimized for increased genome editing efficiency via Chen B et al., 2013)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyPromoterU6Available sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MTK234_055
Plasmid#123920PurposeEncodes the spCas9 gRNA GFP dropout expression cassette (bovine u6 promoter and constant region 2) as a type 234 part to be used in the MTK systemDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA-GFPDROPOUT-for Sp Cas9 bu6_20N_cr2
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK0_046
Plasmid#123976PurposeEncodes the Cas9 Thal5.10-2_hg18 homology destination with Hygromycin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemhDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthThal5.10-2_hg18 CAS9 Destination - HygroR
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRDA_156
Plasmid#179089Purposenuclease Cas expressionDepositorInsertCas9-VRER
UseCRISPR and LentiviralAvailable sinceJan. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_155
Plasmid#179088Purposenuclease Cas expressionDepositorInsertCas9-VQR
UseCRISPR and LentiviralAvailable sinceJan. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_151
Plasmid#179084Purposenuclease Cas expressionDepositorInsertCas9-HF
UseCRISPR and LentiviralAvailable sinceJan. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-MAFB-sg
Plasmid#194720Purposepx458 with guide RNA that target hMAFBDepositorAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.103
Plasmid#184988PurposeExpress Cas9-P2A-Eco1RTDepositorInsertCas9-P2A-Eco1RT
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.102
Plasmid#184987PurposeExpress -Eco1 RT-P2A-Cas9DepositorInsertEco1RT-P2A-Cas9
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
A3Bi-Cas9n-UGI
Plasmid#119135PurposeBase editor made from full-length APOBEC3B with an L1 intron to prevent self-restrictionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAPOBEC3B L1 intron-Cas9 nickase-UGI
UseCRISPRMutationL1 intron insertionPromoterCMVAvailable sinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-Hypa-nCas9n-A69
Plasmid#125645Purposemicro-injection of poly-adenylated Hypa-nCas9n RNADepositorInsertHypa-nCas9n
UseRna in vitro transcription vectorMutationN692A, M694A, Q695A, H698A from wild-type Cas9PromoterT3Available sinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA1-Tat
Plasmid#138478PurposeExpresses HIV Tat for efficient sgRNA packaging.DepositorInsertTat
ExpressionMammalianAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPR-HOT-P2A-Clover-BlastR
Plasmid#138568PurposeUniversal Cleavable Donor Plasmid for tagging with P2A-Clover-BlastR using NHEJDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertP2A-clover-BlastR
UseCRISPRAvailable sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MTK0_003
Plasmid#123925PurposeEncodes the spCas9 cassette and spCas9 gRNA GFP dropout expression cassette final destination vector as a type 0 part to be used in the MTK systemDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9-sgRNA destination
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
XClone_Cas9_KRAB_T2A_BFP
Plasmid#141208PurposeTunable and temporal expression control of dCas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9
ExpressionMammalianAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only