We narrowed to 14,306 results for: Ski
-
Plasmid#178031PurposeRetroviral vector for the purpose of overexpression in mammalian cell cultureDepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationFirst N-Terminal 27aa are deletedPromoterGAGAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLA1 ISCmut
Plasmid#160808PurposeExpress ISC mutant POLA1DepositorInsertPOLA1 ISCmut (POLA1 Human)
UseRetroviralMutationCodon optimized, C1354S, C1359S, C1377S, C1380SAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iGluSnFR3.v857.PDGFR
Plasmid#178333PurposeFluorescent reporter for glutamate, third generation, variant 857. iGluSnFR3.v857DepositorInsertpAAV CAG iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.PDGFR
Plasmid#178329PurposeFluorescent reporter for glutamate, third generation, variant 857. iGluSnFR3.v857DepositorHas ServiceAAV1InsertpAAV hSyn iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGGG-AH-VRT-A2
Plasmid#163703PurposeWheat transformation vector pGoldenGreenGate (pGGG) with OsActinP:: hygromycin (hpt) selection and the full native Triticum polonicum VRT-A2 gene (native prom::genomic seq::3'UTR)DepositorInsertsOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
Triticum polonicum VRT-A2 genomic sequence (Native promoter:: genomic sequence::3'UTR) + Nos Terminator
ExpressionPlantPromoterRice - Os Actin promoter and Triticum polonicum V…Available SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iGluSnFR3.v857.GPI
Plasmid#178335PurposeFluorescent reporter for glutamate, third generation, variant 857 in GPI backbone. iGluSnFR3.v857.GPIDepositorInsertpAAV CAG iGluSnFR3 v857.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI Anchor, IgK-chain, and Myc epi tagExpressionMammalianAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Nematode, Human)
TagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.SGZ
Plasmid#178330PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV hSyn iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.GPI
Plasmid#178331PurposeFluorescent reporter for glutamate, third generation, variant 857 in GPI backbone. iGluSnFR3.v857.GPIDepositorHas ServiceAAV1InsertpAAV hSyn iGluSnFR3 v857.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI Anchor, IgK-chain, and Myc epi tagExpressionMammalianAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v82.GPI.codonopt
Plasmid#175184PurposeFluorescent reporter for glutamate, third generation, variant 82 in GPI backbone. iGluSnFR3.v82.GPIDepositorInsertpAAV hSyn FLEX iGluSnFR3 v82.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI Anchor, IgK-chain, and Myc epi tagExpressionMammalianPromoterhuman SynapsinAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.IgK-NGR
Plasmid#196227PurposeFluorescent reporter for glutamate, third generation, variant 857 in NGR backbone. iGluSnFR3.v857.NGRDepositorInsertpAAV hSyn iGluSnFR3 v857.NGR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and NGR TM DomainExpressionMammalianAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.FLEX.iGluSnFR3.v857.GPI
Plasmid#196218PurposeFluorescent reporter for glutamate, third generation, variant 857 in GPI backbone. iGluSnFR3.v857.GPIDepositorInsertpAAV CAG.FLEX iGluSnFR3 v857.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI Anchor, IgK-chain, and Myc epi tagExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.iGluSnFR3.v857.GPI
Plasmid#178338PurposeFluorescent reporter for glutamate, third generation, variant 857 in GPI backbone. iGluSnFR3.v857.GPIDepositorInsertpAAV GFAP iGluSnFR3 v857.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI Anchor, IgK-chain, and Myc epi tagExpressionMammalianAvailable SinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.iGluSnFR3.v857.SGZ
Plasmid#178337PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV GFAP iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.FLEX.iGluSnFR3.v857.PDGFR
Plasmid#196219PurposeFluorescent reporter for glutamate, third generation, variant 857 in PDGFR backbone. iGluSnFR3.v857.PDGFRDepositorHas ServiceAAV2InsertpAAV CAG FLEX iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLP-FRT.iGluSnFR3.v857.GPI
Plasmid#196223PurposeFluorescent reporter for glutamate, third generation, variant 857 in GPI backbone. iGluSnFR3.v857.GPIDepositorInsertpAAV hSyn FLP-FRT iGluSnFR3 v857.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI anchor, IgK-chain, and Myc epi tagExpressionMammalianAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-ACE2-his expression plasmid
Plasmid#158089PurposeExpresses ACE2 in mammalian cellsDepositorAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only