We narrowed to 7,789 results for: Trac
-
Plasmid#178800PurposeHigh-fidelity eSpCas9(1.1) with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pLV.EF1α.mEmerald.CD9.miR9T
Plasmid#170452PurposeLentiviral plasmid that encodes mEmerald-CD9 fusion protein with microRNA 9 tandem cassette to restrict expression to microglia with EF1-alpha promoter.DepositorAvailable SinceMay 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFPC2-Gephyrin P1
Plasmid#68815Purposeexpression of fluorescent tagged Geph in mammalian cellsDepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyri…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL A WT
Plasmid#202413PurposeExpression of GFP-tagged PODXL (isoform A) WTDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-flag-mAdrb1-WPRE
Plasmid#223671PurposeAAV expression of flag-mAdrb1 from GfaABC1D promoterDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
LV-Sox10MCS5-GFP-EF1a-mCherry
Plasmid#115782PurposeSox10-MCS5-GFP and a constitutive EF1α-mCherry reporter plasmid. Construct generates constitutive red fluorescence and basal promoter cfos conjugated SOXMCS5 enhancer driven GFP expression in a cell.DepositorInsertsmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
EF1alpha promoter driven constitutive mCherry
UseLentiviralTagsEF1α promoter fused to mCherry and cfos promoter …PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-VSV
Plasmid#242781PurposeAAV transfer plasmid expressing eGFP-VSV under a CAG promoter.DepositorInsertEGFP
UseAAVTagsVSV G tagPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
SuExp His-Myc-hPLD3
Plasmid#173851PurposeProtein expression plasmid for recombinant His-Myc tag human PLD3DepositorInsertPLD3 (PLD3 Human)
Tags6xHis, Myc, Factor X cleavableExpressionMammalianMutationintracellular and transmembrane domain truncated,…PromoterCMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIBN-GFP-Sec61B
Plasmid#104177PurposeExpresses fusion of CIB1 (1-170) with GFP and Sec61BDepositorAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
UPRT-mCh-Nluc-P2A-neo-UPRT
Plasmid#135015PurposeExpresses mCherry protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum UPRT locusDepositorInsertsmCh-Nluc-P2A-neo
UPRT 5'UTR
UPRT 3'UTR
UseCryptosporidium expressionTagsmCherry and Nluc-neoPromoterCryptosporidium actin and enolaseAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL B WT
Plasmid#202414PurposeExpression of GFP-tagged PODXL (isoform B) WTDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
SuExp His-Myc-hPLD4
Plasmid#173852PurposeProtein expression plasmid for recombinant His-Myc tag human PLD4DepositorInsertPLD4 (PLD4 Human)
Tags6xHis, Myc, Factor X cleavableExpressionMammalianMutationintracellular and transmembrane domain truncated,…PromoterCMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
tetO-ESRRA
Plasmid#170683Purposedoxycycline-inducible overexpression of ESRRADepositorInsertESRRA (ESRRA Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-H2B-Maroon-P2A-3xnls-Tq-Ca-FLITS
Plasmid#145027PurposeLentiviral vector for a Turquoise calcium sensor (GECI) that reports with lifetime and intensity changes - co-expresses a nuclear markerDepositorInsert3xnls-Tq-Ca-FLITS
UseLentiviralTags3xnls-Tq-Ca-FLITS and H2B-MaroonExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H326
Plasmid#228242PurposemT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H332
Plasmid#228250PurposemT2Del_EPACdDEPCD_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-NRG1-ScNeo
Plasmid#209900PurposeTo monitor the status of NRG1, the plasmid encodes a recombinant NRG1 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only