We narrowed to 14,321 results for: cas9
-
Plasmid#223079PurposepCMV and pT7 Human expression plasmid for SpCas9 enzyme with LWKYQS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized nuclease SpCas9(LWKYQS)-P2A-EGFP
UseCRISPRTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9(LWKYQS)=D1135L, S1136W, G1218K, E1219Y, R1…PromoterCMV and T7Available sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
7a sgRNA for EJ7-GFP and 4-μHOM reporters
Plasmid#113620PurposesgRNA/CAS9 expression plasmid to induce the 5’ double-strand break in both the EJ7-GFP and 4-μHOM reportersDepositorInsert7a sgRNA
UseCRISPRExpressionMammalianAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
nos-Cas9.874Z1
Plasmid#112685PurposeExpress hSpCas9 under nanos promoterDepositorInserthSpCas9
Tags3x FLAG, EGFP, and NLSExpressionInsectMutationHumanized Cas9 bacterial sequencePromoternanosAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ubiq-Cas9.874W
Plasmid#112686PurposeExpress hSpCas9 under Ubiquitin-63E promoterDepositorInserthSpCas9
Tags3x FLAG, EGFP, and NLSExpressionInsectMutationHumanized Cas9 bacterial sequencePromoterUbiquitin-63E promoterAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMG18311_2xUGI_3xHA
Plasmid#136657PurposeExpresses St1BE4max-LMG18311 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_CNRZ1066_2xUGI_3xHA
Plasmid#136654PurposeExpresses St1BE4max-CNRZ1066 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-T2A-mNeonGreen-2-bc6
Plasmid#250524PurposeExpresses Cas9 and mNeonGreen. Barcode is added to the vector.DepositorInsertM13F-AATTGGCC
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJan. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFGRNA-LbCpf1-SpCas9
Plasmid#119673PurposeEmpty vector for cloning LbCpf1-SpCas9 fgRNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFGRNA-AsCpf1-SpCas9
Plasmid#119674PurposeEmpty vector for cloning AsCpf1-SpCas9 fgRNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AOI-WT-Cas9-sg-mouse Ezh2-E10-GFP
Plasmid#91879PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Ezh2DepositorPublicationAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
G1397 DddAtox-C–dSpCas9
Plasmid#157836Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertbpNLS–G1397 DddAtox-C–dSpCas9–UGI–UGI–bpNLS
UseCRISPRAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#2
Plasmid#107730PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#1
Plasmid#107729PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pZac2.1 EFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
Plasmid#78607PurposeA single vector AAV-Cas9 system containing SaCas9 under EFs promoter, gRNAs targeting Dmd introns 22 and 23DepositorInsertEFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterEF1a-short; U6Available sinceSept. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA.v2_U6(SpCas9_I-SceI)-(AsCas12a(dual-gRNA)_PacI-PacI)_PGK-puro
Plasmid#189636PurposeLentiviral expression of single SpCas9 and dual AsCas12a gRNAs for generating combinatorial CHyMErA.v2 3Cs librariesDepositorInserthU6 Cas9-Cas12a-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-TBK1-gRNA (PX459)
Plasmid#221550PurposeExpresses Cas9 and gRNA for disruption of TBK1 gene in human cellsDepositorAvailable sinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCC_08 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dxCas9NG-NLS-VPR-2A-Puro-WPRE
Plasmid#139093PurposeExpresses human codon-optimized inactive xCas9-NG fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdxCas9-NG-VPR
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T,R324L, S409I, E480K, E543D, M6…Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only