We narrowed to 384 results for: Tdh
-
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pL90-Nat-2xHO
Plasmid#139069PurposeCRISPR/Cas9 engineering of the HO endonuclease gene with nourseothricin selectionDepositorInsertTwo guide RNAs targeting the HO endonuclease
ExpressionBacterial and YeastPromoterTDH3Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NgBR
Plasmid#203165PurposeYeast expression vector for hNUS1DepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
p21StBD
Plasmid#190269PurposeConstitutively expresses a protein of interest fused to a GAL4 DNA-binding domain. Targeted integration to genomic locus YPRC-tau 3, Chromosome XVI.DepositorTypeEmpty backboneUseSynthetic Biology; Yeast genome-integrating vectorTagsGAL4-BDPromoterTDH3Available SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTH728-CEN-RLuc/maxCFLuc
Plasmid#38212DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH726-CEN-RLuc/minCFLuc
Plasmid#38210DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH744-CEN-RLuc/slowmaxCFLuc
Plasmid#38224DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH742-CEN-RLuc/slowminCFLuc
Plasmid#38222DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NgBR R290H
Plasmid#203167PurposeYeast expression vector for hNUS1 R290HDepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC26A4
Plasmid#132032PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC26A4 (SLC26A4 Human)
ExpressionMammalianAvailable SinceOct. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pATP416-pluxO5-pphlO6-crtYBI
Plasmid#165977PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and 2,4-diacetylphloroglucinol in yeast expressing PhlTA and LuxTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pATP416-ptetO7-pphlO6-crtYBI
Plasmid#165976PurposeExpresses carotenoid biosynthesis gene in response to 2,4-diacetylphloroglucinol and doxycycline in yeast expressing rtTA and PhlTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pphlO6), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-ptetO7-crtYBI
Plasmid#165975PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and doxycycline in yeast expressing LuxTA and rtTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW1-hCIT
Plasmid#203166PurposeYeast expression vector for human DHDDSDepositorAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUDP046
Plasmid#107062PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting KU80 from Ogataea parapolymorphaDepositorInsertHH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH731-2µ-RLuc/minCFLuc
Plasmid#40601DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only