We narrowed to 983 results for: plasmids spcas9
-
Plasmid#138295PurposegRNA for CRISPR/Cas9 knockout of human TRIM21DepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)
Plasmid#85041PurposeThis plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9.DepositorInsertloxP-stop-loxP
UseCRISPRExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRTH-P2A-EGFP (RMD21)
Plasmid#197503PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-NRTH-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRTH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRRH-P2A-EGFP (RMD51)
Plasmid#197502PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRRH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-NRRH-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRRH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRCH-P2A-EGFP (RMD55)
Plasmid#197501PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRCH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRCH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRCH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRRH-P2A-EGFP (RMD47)
Plasmid#197499PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRRH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRRH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRRH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRCH-P2A-EGFP (RMD57)
Plasmid#197504PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRCH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-ABE8e-NRCH-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRCH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-HF1-P2A-EGFP (LM422)
Plasmid#197505PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HF1(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HF1-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HF1(D10A/N497…PromoterCMV and T7Available SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR-Nick2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75243PurposeCRISPR/Cas9 NICKASE plasmid against human Ikaros (2/2)DepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75242PurposeCRISPR/Cas9 NICKASE plasmid against human Ikaros (1/2)DepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
Helios-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75246PurposeCRISPR/Cas9 NICKASE plasmid against human Helios (1/2)DepositorInsertsgRNA against human Helios (IKZF2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
Helios-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75247PurposeCRISPR/Cas9 NICKASE plasmid against human Helios (2/2)DepositorInsertsgRNA against human Helios (IKZF2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
Plasmid#42229PurposeThis plasmid separately encodes a human codon-optimized SpCas9, a tracrRNA and customizable crRNA.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianAvailable SinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g1_CASH-1
Plasmid#188975PurposeA human codon-optimized SpCas9 nickase and chimeric g1 guide RNA expression plasmid.DepositorInsertg1 guide RNA
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only