We narrowed to 4,635 results for: abo
-
Plasmid#253782PurposeThird generation lentiviral expression Gateway cloning destination vector under a Tet-On inducible promoter for expression of a gene of interest linked to EGFP by an IRES.DepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pLV-hPGK-DEST-IRES-Neo
Plasmid#253772PurposeThird generation lentiviral expression Gateway cloning destination vector under a hPGK promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-DEST-IRES-Hygro
Plasmid#253767PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to hygromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-DEST-IRES-Neo
Plasmid#253768PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-TRE-DEST-UbC-tTSrtTA-IRES-Puro
Plasmid#253781PurposeThird generation lentiviral expression Gateway cloning destination vector under a Tet-On inducible promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hPGK-DEST-IRES-Hygro
Plasmid#253771PurposeThird generation lentiviral expression Gateway cloning destination vector under a hPGK promoter for expression of a gene of interest linked to hygromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-Puro
Plasmid#215362PurposeExpresses a rat Letm1 specific shRNADepositorInsertLetm1 shRNA Target sequence (Letm1 Rat)
UseLentiviralAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-mTagBFP2
Plasmid#215363PurposeExpresses a rat Letm1 specific shRNA and a BFP under a separate hPGK promoterDepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-miRFPnano
Plasmid#215365PurposeExpresses a rat Letm1 specific shRNA and miRFPnano under a separate hPGK promoterDepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-Drosophila-Letm1
Plasmid#212663PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and Drosophila-Letm1DepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_12S→E_S305C/A326P
Plasmid#248868PurposeExpresses MBP-tagged C-terminal domain of TDP-43 with 12S→E, S305C and A326P.DepositorInsertTDP-43_CTD_12S→E_S305C/A326P (TARDBP Human)
Tags6xHis tags-MBPExpressionBacterialMutationchanged S292E, S369E, S377E, S379E, S387E, S389E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_13S→E_S317C
Plasmid#248845PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with 13S→E and S317C.DepositorInsertTDP-43_CTD_13S→E_S317C (TARDBP Human)
Tags6xHis-tagsExpressionBacterialMutationchanged S292E, S305E, S369E, S377E, S379E, S387E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_13S→E_S273C
Plasmid#248859PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with 13S→E and S273C.DepositorInsertTDP-43_CTD_13S→E_S273C (TARDBP Human)
Tags6xHis-tagsExpressionBacterialMutationchanged S292E, S305E, S369E, S377E, S379E, S387E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_12S→E_S305C
Plasmid#248867PurposeExpresses MBP-tagged C-terminal domain of TDP-43 with 12S→E and S305C.DepositorInsertTDP-43_CTD_12S→E_S305C (TARDBP Human)
Tags6xHis tags-MBPExpressionBacterialMutationchanged S292E, S369E, S377E, S379E, S387E, S389E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB CRIV Gc Spike H6
Plasmid#240163PurposePlasmid for making PiggyBac stable cell line expressing Cristoli virus (CRIV) glycoprotein Gc spike with a C-terminal His6 tagDepositorInsertCRIV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 478-906 onlyAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMWCAVI_H6BAP-OROV_N
Plasmid#240162PurposePlasmid encoding Oropouche virus (OROV) nucleoprotein (N) with an N-terminal His6 and biotin acceptor peptide (BAP, a.k.a. AviTag) for expression in E. coliDepositorInsertNucleoprotein
Tags6xHis, Biotin acceptor peptide (BAP, a.k.a. AviTa…ExpressionBacterialAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mEtfdh-AAA6
Plasmid#232317PurposeExpression of mouse mutant Etfdh (AAA6)DepositorInsertEtfdh (Etfdh Mouse)
UseLentiviralMutationPAM Sequence Mutations: (G36C; T39C, C42T; C72T, …Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mEtfdh-AAG6
Plasmid#232315PurposeExpression of mouse mutant Etfdh (AAG6)DepositorInsertEtfdh (Etfdh Mouse)
UseLentiviralMutationPAM Sequence Mutations: (G36C, T39C, C42T, C72T, …Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-E166D
Plasmid#226720PurposeMammalian expression of cytosolic mouse CNDP2 mutant E166DDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only