We narrowed to 9,297 results for: yeast expression
-
Plasmid#71128PurposeThis plasmid contains a Cas9 Activator for yeast. The activator is about 1.2-1.8 X more potent than just dCas9-VP64 fusion in yeast. It is on a single copy CEN/ARS plasmid with Ura marker, pRS416.DepositorInsertGal4-dCas9-VP64
UseTagsNLS n-terminal, N terminal Gal4 Activator domain,…ExpressionYeastMutationPromoterTef1Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKdH_P-GAP-ScADH2+P-GAP*-ScALD6+ScACS1*
Plasmid#126739Purposeyeast plasmid overexpressing ADH2,ALD6 and ACS1 from Saccharomyces cerevisiaeDepositorInsertadh2, acs1*, ald6
UseTags6xHis,MycExpressionYeastMutationT3542C and A30S, S629N (please see depositor comm…PromoterGAPAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
p404GALS
Plasmid#17435DepositorInsertGALS promoter + polylinker + CYC1 terminator (GAL1 Budding Yeast)
UseTagsExpressionBacterial and YeastMutationGALS promoter is between SacI and XbaI restrictio…PromoterAvailable SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
pRS414-7x2-PHO5-GFP-hPLC delta PH domain dimer
Plasmid#58837PurposeExpresses GFP-Tagged Human PLC delta PH domain in yeastDepositorInsert2x Phospolipase C delta1 PH domain (Plcd1 Rat)
UseTagsGFPExpressionYeastMutationPromoterPHO5Available SinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CUP1-1
Plasmid#166086PurposePlasmid for constituive spCas9 and tet-inducible CUP1-1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertCUP1-1 (CUP1-1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH340-SUP45(1-242)-GalBD
Plasmid#29740DepositorInsertSUP45 (SUP45 Budding Yeast)
UseTagsGal Activation domain and MycExpressionYeastMutationCodons 1-242 of the yeast SUP45 gene onlyPromoterAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
Sc FLAG-S6-RFC1-pRS405/GAL-L
Plasmid#239473PurposeOverexpress Sc FLAG-S6-RFC1 in yeast (integrated)DepositorInsertSc FLAG-S6-RFC1 (RFC1 Budding Yeast)
UseTags3X FLAG followed by S6ExpressionYeastMutationPromoterAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc [Pol31 + Pol32]-pRS403/GAL
Plasmid#239199PurposeOvererxpress Sc Pol31 & Pol32 when integrated into yeast (S. cer)DepositorUseTagsExpressionYeastMutationPromoterAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Peripherin/pAS2-1
Plasmid#98135PurposePeripherin (NM_006262) in DNA-binding domain (BD) vector, used for yeast-two hybridDepositorAvailable SinceAug. 21, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTH341-SUP45(139-437)-GalBD
Plasmid#29741DepositorInsertSUP45 (SUP45 Budding Yeast)
UseTagsGal Activation domain and MycExpressionYeastMutationCodons 139-437 of the yeast SUP45 gene onlyPromoterAvailable SinceSept. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH339-SUP45(1-138)-GalBD
Plasmid#29739DepositorInsertSUP45 (SUP45 Budding Yeast)
UseTagsGal Activation domain and MycExpressionYeastMutationCodons 1-138 of the yeast SUP45 gene onlyPromoterAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only