We narrowed to 4,466 results for: Abo;
-
Plasmid#55629PurposeAn N-terminal mCerulean fragment was fused to Ggamma-12. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-12 (GNG12 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-12 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVQ CMV NanoV1-2a-EGFP ferritin
Plasmid#79649PurposeExpresses camelid anti-GFP nanobody fused to TRPV1 and GFP-ferritin chimera fusion proteinDepositorInsertsUseAdenoviralExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVQ CMV NanoV1Mutant-2a-EGFP ferritin
Plasmid#79650PurposeExpresses camelid anti-GFP nanobody fused to TRPV1 with mutant pore region and GFP-ferritin chimera fusion proteinDepositorInsertsUseAdenoviralExpressionMammalianMutationisoleucine 679 changed to lysinePromoterCMVAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCARgsg(anti-CD19)
Plasmid#215759PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2 (enhanced expression by GSG-2A linker)DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-1 in pcDNAI/Amp
Plasmid#54468PurposeAn amino-terminal YFP fragment was fused to Gbeta-1. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP (1-158)/beta-1 (GNB1 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-1 was amplified via PCR, which removed an i…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-2 in pcDNAI/Amp
Plasmid#54469PurposeAn amino-terminal YFP fragment was fused to Gbeta-2. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-2 (GNB2 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-5 in pcDNAI/Amp
Plasmid#54470PurposeAn amino-terminal YFP fragment was fused to Gbeta-5. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-5 (GNB5 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-1 in pcDNAI/Amp
Plasmid#55592PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-1. When co-expressed with an amino-trerminal CFP or YFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCFP (159-238)-Beta 1 (GNB1 Human, Aequorea victoria)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-EGFP-MTHFD1-WPRE
Plasmid#250370PurposeLentiviral expression of human MTHFD1 with N-terminal EGFP under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCAR(anti-CD19)
Plasmid#215758PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2DepositorAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUltra-MDH1-ME1
Plasmid#184465PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)DepositorUseLentiviralTagsfused to T2AExpressionMammalianMutationdeletion of stop codonPromoterUbCAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
Plasmid#184549PurposeRetroviral vector to co-express human MDH1 with 3xFLAG tag and human ME1 with HA tagDepositorUseRetroviralTags3xFLAG and HA tagExpressionMammalianPromoterCMVAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-EGFP-MTHFD1 K56R-WPRE
Plasmid#250371PurposeLentiviral expression of human MTHFD1 carrying K56R mutation with N-terminal EGFP and puromycin resistance cassette under PGK promoter. Mutation was generated by Q5 site-directed mutagenesis.DepositorInsertMTHFD1 (MTHFD1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationK56RPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-EGFP-MTHFD1 K384E-WPRE
Plasmid#250372PurposeLentiviral expression of human MTHFD1 carrying K384E mutation with N-terminal EGFP and puromycin resistance cassette under PGK promoter. Mutation was generated by Q5 site-directed mutagenesis.DepositorInsertMTHFD1 (MTHFD1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationK384EPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-tagBFP-NUDT5-WPRE
Plasmid#250375PurposeLentiviral expression of human NUDT5 with N-terminal tagBFP under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5-WPRE
Plasmid#250377PurposeLentiviral expression of human NUDT5 with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 Y74E-WPRE
Plasmid#250385PurposeLentiviral expression of human NUDT5 Y74E with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5 G150V-WPRE
Plasmid#250402PurposeLentiviral expression of human NUDT5 G150V with N-terminal mCherry seperated by a flexible GSG-linker and P2A under CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianMutationG150VPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5 P158I-WPRE
Plasmid#250403PurposeLentiviral expression of human NUDT5 P158I with N-terminal mCherry seperated by a flexible GSG-linker and P2A under CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianMutationP158IPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only