We narrowed to 5,360 results for: Mos;
-
Plasmid#219955PurposeFor protein purification from EcoliDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only
-
Polymerase expression - pCMV-T7-EcKlenow (LM2692)
Plasmid#208963PurposeUnfused EcKlenow DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertEcKlenow-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
GUT BuGZ delta ZF2
Plasmid#84026PurposeExpression of GFP tagged mutant BuGZ in human cellsDepositorInsertBuGZ (ZNF207 Human)
UseLentiviralTagsTurboGFPExpressionMammalianMutationdelta 35-58; Q394RPromoterUCOE / SFFVAvailable SinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUT BuGZ delta ZF1
Plasmid#84025PurposeExpression of GFP tagged mutant BuGZ in human cellsDepositorInsertBuGZ (ZNF207 Human)
UseLentiviralTagsTurboGFPExpressionMammalianMutationdelta 13-34; Q394RPromoterUCOE / SFFVAvailable SinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
GUT BuGZ delta GLEBS
Plasmid#84028PurposeExpression of GFP tagged mutant BuGZ in human cellsDepositorInsertBuGZ (ZNF207 Human)
UseLentiviralTagsTurboGFPExpressionMammalianMutationdelta 357−373; Q394RPromoterUCOE / SFFVAvailable SinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pME-Lifeact-EGFP-3xHA (JDW 1322)
Plasmid#224494PurposeGateway compatible middle entry clone containing Lifeact-EGFP (EGFP F-actin reporter)DepositorInsertLiefact-EGFP-3xHA
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-2xPH-TAPP1 R211L mutant
Plasmid#161991PurposeExpresses two mutated tandem repeats of Tapp1 PH domain (phosphoinositide binding-deficient mutant of TAPP1, R211L, can't bind PI(3,4)P2). Fused to eGFPDepositorAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-3G
Plasmid#194464PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-dnMCAK
Plasmid#205995Purposeinducible expression of HA-dnMCAKDepositorInsertdnMCAK
TagsHAExpressionMammalianPromoterpTightAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF
Plasmid#101773PurposeExpresses BAF in human cells (with EGFP produced from the same transcript as expression control)DepositorAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Frt-V5-hspB5
Plasmid#63106PurposeExpression of HSPB5 (small HSP) tagged with V5 in mammalian cellsDepositorAvailable SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Frt-V5-hspB8
Plasmid#63109PurposeExpression of HSPB8 (small HSP) tagged with V5 in mammalian cellsDepositorAvailable SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR
Plasmid#135500PurposeMammalian expression of FLAG-tagged TAPBPRDepositorInsertTAPBPR (TAPBPL Human)
TagsLuminal FLAG epitope tag and Signal peptide from …ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-AuroraB kd K106R
Plasmid#108493Purposeexpression of EGFP-AuroraB kinase dead (K106R)DepositorInsertAuroraB (AURKB Human)
TagsEGFPExpressionMammalianMutationKinase death K106APromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN244 - CTCF-AID[71-114]-eGFP-FRT-Blast-FRT targeting construct
Plasmid#92140PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse CTCF locus using BLASTICIDIN selection. Auxin-inducible degron system.DepositorInsertAID[71-114]-eGFP
UseMouse TargetingExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-LAP3
Plasmid#217660PurposeFor gateway cloning of LAP3DepositorInsertLAP3 (LAP3 Human)
Available SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp2-a
Plasmid#40047DepositorAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
YA1529: pAAV_hSyn-QuasAr3-P2A-CheRiff
Plasmid#107700Purposein vivo voltage imagingDepositorInsertQuasAr3-P2A-CheRiff
UseAAVExpressionMammalianPromoterhuman synapsin IAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only