We narrowed to 12,348 results for: SHA;
-
Plasmid#215490PurposeLentiviral expression and easy visualization of mutated alpha-synuclein (2nd amino acid aspartate mutated to arginine) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsEGFPExpressionMammalianMutationD (second aa) mutated to RPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2E)-GFP
Plasmid#215491PurposeLentiviral expression and easy visualization of mutated alpha-synuclein (2nd amino acid aspartate mutated to glutamate) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsEGFPExpressionMammalianMutationD (second aa) mutated to EPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
Plasmid#195502PurposeCas9 nickase expression vector bearing a sgRNA targeting Exon 2 of human SOX17DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199 L188A/L192A
Plasmid#108288PurposeExpresses residues 186-199 with L to A mutations at residues 188 and 192 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-286DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199 L192A/L195A
Plasmid#108290PurposeExpresses residues 186-199 with L to A mutations at residues 192 and 195 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-287DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
18065-M01-412
Plasmid#225664PurposeLentiviral expression of FLAG-tagged fluorescent proteins for immunohistochemical detection in FFPE tissueDepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterSORE6-mCMVp and WPRE-SV40pAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
18065-M02-412
Plasmid#225665PurposeLentiviral expression of FLAG-tagged fluorescent proteins for immunohistochemical detection in FFPE tissueDepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterSORE6-mCMVp and WPRE-SV40pAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Nterm_FlagHa
Plasmid#127343PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningTagsFlag- HA- Tandem EpitopesMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-Neo-TetO-Cdk13_Untagged
Plasmid#127344PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into a dox-inducible piggybac destination vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UsePiggybac transposase vectorTagsNoneExpressionMammalianMutationBase pairs 1-1554 of transgene are codon optimize…PromoterTetO PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-Neo-TetO-Cdk13_Nterm_FlagHa
Plasmid#127345PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into a dox-inducible piggybac destination vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UsePiggybac transposase vectorTagsFlag- HA- Tandem EpitopesExpressionMammalianMutationBase pairs 1-1554 of transgene are codon optimize…PromoterTetO PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-RASA1-3'UTR (mut - miR-206 site)
Plasmid#62576PurposeTranslational Luciferase Reporter containing the mutated 3'UTR of RASA1. The miR-206 binding site was mutated.DepositorInsertRASA1 (RASA1 Human)
UseLuciferaseTagsNoneMutationmiR-206 binding site mutated (ACATTCCA --> AAC…Available SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
Jacquere (split-vector)
Pooled Library#247026PurposeHuman genome-wide CRISPR knockout library for the use of S. pyogenes Cas9. Each gene is targeted by 3 constructs.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-human-TF-gRNA-puromycin
Pooled Library#162275PurposeKnockout library targeting a set of human transcription factors for loss-of-function screening.DepositorSpeciesHomo sapiensUseLentiviralAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Jacquere (all-in-one vector)
Pooled Library#247027PurposeHuman genome-wide CRISPR knockout library for the use of S. pyogenes Cas9. Each gene is targeted by 3 constructs.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Julianna (split-vector)
Pooled Library#247028PurposeEnriched for effective guides through prioritization of guides with strong on-target activity. Designed against current gene annotations, offering coverage of the contemporary mouse genome.DepositorExpressionMammalianSpeciesMus musculusUseCRISPR and LentiviralAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mouse sphingolipid metabolism knockout library
Pooled Library#206249PurposeThe sphingolipid metabolism library targets 82 mouse genes in the de novo ceramide and downstream sphingolipid metabolism pathways.DepositorUseCRISPR and LentiviralAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
MinLibCas9
Pooled Library#164896PurposeGenome-wide knockout library designed with two sgRNAs per gene.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mouse lipid metabolism knockout library
Pooled Library#206248PurposeThe lipid metabolism library contains guide RNAs against 295 genes targeting mouse genes encoding enzymes that directly impact lipid metabolism.DepositorUseCRISPR and LentiviralAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only