Mouse CRISPR Knockout Pooled Library (Julianna)
(Pooled Library #247028, #247028-LV)

• Purpose:

  This is a mouse genome-wide CRISPR knockout library for the use of Streptococcus pyogenes Cas9. Each gene is targeted by three constructs.

  The Julianna library is enriched for effective guides through prioritization of guides with strong on-target activity as predicted with the Rule Set 3 Sequence + Target Score (DeWeirdt et al., 2022 ) and strategic exclusion of guides with excessive off-target activity. Further, Julianna is designed against current gene annotations sourced from Ensembl v102, thereby offering coverage of the contemporary mouse genome.

• Vector Backbone:

  pMV_AA050 (Plasmid #216107) - does not express Cas9

• Depositing Labs: John Doench, David Root
• Publication: Drepanos et al. bioRxiv. 2025 Aug 27. doi: 10.1101/2025.08.26.672375.

Library Details

• Species: Mouse (GRCm38)
• Genes targeted: 21,895
• gRNAs per gene: 3
• Total gRNAs: 63,017
• Controls: 900 intergenic-targeting, 100 non-targeting
• Lentiviral generation: 3rd

Library Shipping

Each library is delivered in a microcentrifuge tube on blue ice. The tube's contents will not necessarily be frozen. For best results, minimize freeze/thaws.

• Volume: ∼25 µL
• Concentration: 50 ng/µL

Resource Information

• Protocols:
  • Library Amplification Protocol (PDF, 463 KB)
  • Sequencing Protocol (PDF, 451 KB)
• Depositor Data:
  • Library Target Genes (CSV, 3.1 MB)
  • sgRNA Abundance Graph (PDF, 133 1.7 MB)
• Scripts:
  • The depositing lab recommends using GPP-Jacquere for analysis. Please note that the guide mappings for Julianna instead of Jacquere should be employed.

Terms and Licenses

Academic/Nonprofit Terms:

• UBMTA

Industry Terms:

• Not Available to Industry

Trademarks:

• Zeocin® is an InvivoGen trademark.

Depositor Comments

Deconvolution algorithms for analyzing NGS data: Extract guide sequences from sequencing reads by running PoolQ with the search prefix “CACCG”, and count reads by alignment to a reference file of all possible guides present in the library

Information for Lentiviral Prep (Catalog # 247028-LV, Two-vector system)

Purpose

Ready-to-use lentiviral pooled library for CRISPR screening in mouse cells. Contains 63,017 sgRNAs, targeting 21,895 genes. Lentiviral particles carrying Julianna mouse CRISPR sgRNA knockout library in pMV_AA050.

Delivery

• Volume: Varies depending on titer.
• Titer: ≥ 1 × 10⁷ TU/mL
• Storage: Store at -80 °C. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Pooled Library DNA (20 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPRO SFM
• Selectable Marker: Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Pooled Library Representation:

• To confirm library representation and distribution, we perform next-generation sequencing on the purified plasmid DNA pool that was used to generate lentivirus.

Titering Method:

• ddPCR: 293T cells are transduced with serial dilutions of 247028-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.

PCR confirmation of insert:

• PCR was carried out with primers targeting the Cas9 and P2A. The PCR product was visualized on an agarose gel for size confirmation.
  • Forward primer: GAGGGCCTATTTCCCATGATT

  • Reverse Primer: CACGGCGACTACTGCACTTA

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

Pooled libraries containing at least 1.3 × 10⁸ infectious units are shipped on dry ice at a titer of ≥ 1 × 10⁷ TU/mL. The total volume is divided among several large aliquots and one 1.3 mL aliquot for testing. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using the testing aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in the original publication. Before using this virus, Addgene strongly recommends reading the original publication (Drepanos et al., 2025 ).

A brief and partial description of how to use this virus:

1. Start by optimizing the infection conditions in your cell line in order to achieve 30–50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5 × 10⁶ suspension (or 3 × 10⁶ adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30–50% infection efficiency, and note the infection efficiency for this condition.

2. The Julianna CRISPR knockout pooled library has 63,017 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~2.52 × 10⁷ infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 5.04 × 10⁷ cells to ultimately achieve 3.06 × 10⁷ infected cells.

3. Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5 × 10⁶ suspension (or 3 × 10⁶ adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.

4. Based on a screening MOI of 0.5–1 and the total number of cells infected, Addgene estimates that 3–10 mL of virus will be needed to perform the screen. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

• This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in the original publication (Drepanos et al., 2025 ), perform screen analysis by determining the log₂-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014 ).

• The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.