We narrowed to 11,471 results for: AGA
-
Plasmid#183315PurposeAll-in-One CRISPRko system with a guide RNA that targets PIGF geneDepositorInsertPIGF
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MAP2K1
Plasmid#183308PurposeAll-in-One CRISPRko system with a guide RNA that targets MAP2K1 geneDepositorInsertMAP2K1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ALK
Plasmid#183270PurposeAll-in-One CRISPRko system with a guide RNA that targets ALK geneDepositorInsertALK
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH2028
Plasmid#179771PurposePnlf-1::NLF::2XGFP unc-54 3'UTR C.elegans neural expression of NLF::2XGFPDepositorAvailable SinceMarch 14, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH2437
Plasmid#179780PurposePrgef-1 NLF-1 unc-54 3' UTR C.elegans pan-neural expression of NLFDepositorAvailable SinceMarch 2, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEPQD0CM0058
Plasmid#177022PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertgeraniol 8-oxidase; geraniol-10-hydroxylase; CYP76B6
UseSynthetic BiologyAvailable SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTK73_htz-1
Plasmid#174546Purposehtz-1 targeting gRNA expressionDepositorInserthtz-1 targeting gRNA
ExpressionWormPromoterCe-U6 promoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0766
Plasmid#177032PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertstrictosidine synthase
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0765
Plasmid#177031PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInserttryptophan decarboxylase
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0764
Plasmid#177030PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertsecologanin synthase; CYP72C
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0763
Plasmid#177029PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertloganic acid O-methyltransferase
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0762
Plasmid#177028PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsert7-deoxyloganic acid hydroxylase; CYP72A224
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0062
Plasmid#177027PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsert7-deoxyloganetic acid glucosyl transferase; UGT709C2
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0060
Plasmid#177024PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertiridoid synthase
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0059
Plasmid#177023PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsert8-hydroxygeraniol oxidoreductase; 10-hydroxygeraniol oxidoreductase; alcohol dehydrogenase 10
UseSynthetic BiologyAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0063
Plasmid#177021PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertgeraniol synthase
UseSynthetic BiologyMutationtransit peptide removedAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-DiB1
Plasmid#168800PurposeFluorogen activating protein (FAP) DiB1DepositorInsertFluorogen activating protein DiB1
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-DiB3
Plasmid#168802PurposeFluorogen activating protein (FAP) DiB3DepositorInsertFluorogen activating protein DiB3
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only