We narrowed to 4,903 results for: GCA
-
Plasmid#218523PurposesgRNA targeting human CHKADepositorInsertCHKA (CHKA Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2703-AGER-gRNA2
Plasmid#216472Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiBIRC6-1
Plasmid#202447PurposeExpression of a CRISPRi guide targeting BIRC6DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB1
Plasmid#197354PurposeA knock-out vector for dog ErbB1.DepositorInsertA gRNA targeting the dog EGFR gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003-sgBIRC6-1
Plasmid#202437PurposeExpression of a guide RNA targeting BIRC6DepositorAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHW582
Plasmid#198819PurposeIn vivo calcium indicator. Presence of calcium (Ca2+) increases reporter signal intensity. Based on GCaMP7, improved SNR, higher baseline fluorescenceDepositorInsert15xUAS::GCaMP7b-SL2-mKate2::let-858 3'UTR
ExpressionWormAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #2
Plasmid#198760Purposeconditional knockdown of FDPSDepositorInsertshFDPS #2 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHW580
Plasmid#198816PurposeIn vivo calcium indicator. Presence of calcium (Ca2+) increases reporter signal intensity. Based on GCaMP7, improved SNR, slow kineticsDepositorInsert15xUAS::GCaMP7s-SL2-mKate2::let-858 3'UTR
ExpressionWormAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_2
Plasmid#195135PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Upstream gRNA 2 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgGPAA1 guide 1
Plasmid#193608PurposeGPAA1 knockoutDepositorInsertsgGPAA1 guide 1 (GPAA1 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 1
Plasmid#193598PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 1 (SNRPA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 2
Plasmid#193599PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 2 (SNRPA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-2
Plasmid#124475PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-2_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-3
Plasmid#124476PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-3_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-4
Plasmid#124477PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-4_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E3-3
Plasmid#124484PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E3-3_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgErcc4#1/Cre
Plasmid#173593PurposeExpresses a Ercc4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ercc4 (Ercc4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hBRAF-2
Plasmid#185366PurposeFor mammalian expression of guide RNA: caccgAAAATCCCACAGATGTGGCA that targets human BRAFDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtm#2/Cre
Plasmid#173580PurposeExpresses a Atm-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Atm (Atm Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only