We narrowed to 7,268 results for: gan
-
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pPB CAG SMARCA4 T910M-IRES-EGFP
Plasmid#153949PurposepiggyBac transposon vector with CAG promoter expressing T910M mutant SMARCA4 (FLAG-tagged) and EGFPDepositorAvailable sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMH-HT_SsCHAD-H29A-R32A-R36A-R69A
Plasmid#127787PurposeExpresses a SsCHAD mutant protein in E. coli cellsDepositorInsertSsCHAD (SULM_RS11045 Sulfolobus solfataricus)
Tags6xHis tag + TEV cleavage siteExpressionBacterialMutationmutations in His29, Arg32, Arg36 and Arg69 to AlaAvailable sinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
SGCD-His-bio
Plasmid#52333PurposeExpresses full-length Delta-sarcoglycan ectodomain in mammalian cells. N-terminal His tag, biotinylation sequence and rat Cd4d3+4 tag.DepositorInsertSGCD (SGCD Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
F2R-bio-His
Plasmid#51863PurposeExpresses full-length Proteinase-activated receptor 1 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertF2R (F2R Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
PA-mCherry-miniSOG-Golgi-7
Plasmid#57791PurposeLocalization: Golgi, Excitation: 448 / 473, Emission: 500 / 528DepositorInsertGolgi (B4GALT1 Human)
TagsPA-mCherry-miniSOGExpressionMammalianMutationaa 1-82 of NM_001497.3PromoterCMVAvailable sinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
GRM3 (3SM9)
Plasmid#32870PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertGRM3 (GRM3 Human)
TagsHis tag with TEV cleavage and Honeybee melittin S…ExpressionBacterialAvailable sinceJan. 13, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5FRT/Flag-hINO80N1 (1-262)
Plasmid#29441DepositorAvailable sinceAug. 1, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GRM1
Plasmid#25353PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertGRM1-C254S:L28-G518 (GRM1 Human)
TagsHisExpressionInsectMutationC254S. Contains amino acids L28-G518.Available sinceJuly 29, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
fox1 (a2bp1l)_R (OZ520)
Plasmid#27195DepositorInsertZinc finger array targeting fox1 (a2bp1l) (rbfox1l Zebrafish)
UseZebrafish targetingAvailable sinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
fox1 (a2bp1l)_L (OZ519)
Plasmid#27194DepositorInsertZinc finger array targeting fox1 (a2bp1l) (rbfox1l Zebrafish)
UseZebrafish targetingAvailable sinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHA StreptagII 3C NIS EABR
Plasmid#234988PurposeFor production of Extracellular Vesicles (EVs), with a Strep-tag II labeled Sodium-iodide symporter (NIS), and an HA epitope at its N-terminus on their surfaceDepositorAvailable sinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD86-ST3-His
Plasmid#210664PurposeExpression of the extracellular domain of human CD86 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human CD86 fused to Spytag003 and Histag (CD86 Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRIP12-V2_A755-A841
Plasmid#194759PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceJuly 19, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pnEA-vH_His-TEV-SEPT2-sfCherry2_SEPT6
Plasmid#180313Purposebacterial co-expression of human SEPT2 fused to superfolder Cherry2 and of human SEPT6DepositorTagsHis6-TEV and sfCherry2ExpressionBacterialAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Affibody EGFR:1907.BirA*-pET301/NT-DEST
Plasmid#174691PurposePlasmid encoding for the bacterial expression of a bispecific coding for the anti-EGFR affibody ZEGFR:1907 fused to the mutated form of BirA enzyme, BirA*DepositorInsertAnti-EGFR affibody ZEGFR:1907 fused to mutated form of BirA, BirA*
TagsHIS tagExpressionBacterialMutationR118G mutation in BirAPromoterT7 promoterAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP N1 mitoAURKA
Plasmid#157754PurposeExpression of AURKA:GFP targeted to mitochondriaDepositorInsertAURKA (AURKA Human)
TagsGFPExpressionMammalianMutationAURKA without the first 30 amino acids replaced b…PromoterCMVAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.SV40.THBS1-deltaTSR3-CTD-HA.SV40(polyA)
Plasmid#155194PurposeExpresses truncated (AA 1-690) murine Thrombospondin-1 (THBS1) protein with HA-tag at C-terminusDepositorInsertThrombospondin-1 (Thbs1 Mouse)
UseAAVTagsHA-tagExpressionMammalianMutationTruncated sequence of THBS1 (expresses Amino Acid…PromoterCMVAvailable sinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLR5-CAG-NLS-tdiRFP670-2A-LBR
Plasmid#82620PurposeExpresses NLS-tdiRFP-2A-LBR in mammalian cellsDepositorAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P41nmt1-mEGFP
Plasmid#105140PurposeYeast gene targetingDepositorInsertkanMX6-P41nmt1-mEGFP
Tags41nmt1-mEGFPExpressionBacterial and YeastMutationA206KPromoter41nmt1Available sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only