We narrowed to 5,488 results for: mag
-
Plasmid#196226PurposeFluorescent reporter for glutamate, third generation, variant 857 in NGR backbone. iGluSnFR3.v857.NGRDepositorInsertpAAV hSyn FLEX iGluSnFR3 v857.NGR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and NGR TM DomainExpressionMammalianAvailable sinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-β2AR-μDpTT
Plasmid#182326PurposeBeta-2 adrenergic receptor-targeted Dronpa chromophore-removed FLINC (DrFLINC) pair. Fluctuating red-fluorescent label for live-cell super-resolution imaging.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertbeta2AR-μDronpa-TagRFP-T (ADRB2 Human)
TagsFull-length human beta2 adrenergic receptorExpressionMammalianMutationDronpa contains H193T mutation.PromoterCMVAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTA231-p.Syn-Dendra2Hfx
Plasmid#164660Purposeexpression of H. volcanii codon-optimized Dendra2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDendra2Hfx
UseArchaeal expressionMutationcodon-optimization for Haloferax volcaniiPromoterp.SynAvailable sinceFeb. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ash-mKate2-splitmVenusN
Plasmid#69582PurposeExpresses p53 tagged with mKate2 and split N-term mVenusDepositorInsertp53 (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutation7 silent mutations in p53 DNA to prevent targetin…PromoterEF1alphaAvailable sinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_CH1h-1
Plasmid#105856PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG1-derived CH1 and hinge.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG3 with CH1 and hin…PromoterhEF1-HTLV promAvailable sinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2-3
Plasmid#105851PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived CH2.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with CH2 derived…PromoterhEF1-HTLV promAvailable sinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
ECMAB - pET22b Ag43 160N 6H Mms6
Plasmid#225539PurposeConstruction of extracellular magnetite accumulating bacterial systems.DepositorInsertsIron binding protein
Autotransporter protein
TagsnoExpressionBacterialPromoterT7Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-axon-GCaMP6m (AAV9)
Viral prep#111261-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSynapsin1-axon-GCaMP6m (#111261). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-axon-GCaMP6m plasmid DNA. Synapsin-driven expression of calcium sensor GCaMP6m in axons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRLHygro-pEF1a-p53ashL344P-mKate2-splitmVenusC
Plasmid#69587PurposeExpresses mutated p53-L344P tagged with mKate2 and split C-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - C termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable sinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH1h-3
Plasmid#105850PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived CH1 and hinge.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with CH1 and hin…PromoterhEF1-HTLV promAvailable sinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLK06Hpp-Fab CR3009
Plasmid#239861PurposePlasmid for simultaneous Fab and GFP expression from separate Lac promoters for online monitoring of induction with a GFP sensor station. Fab is expressed as a fusion with alkaline phosphatase.DepositorInsertsTagsHexahistidine tag and bacterial alkaline phosphat…ExpressionBacterialMutationF64L, S65T, Q80R, M153T and V163APromoterLac promoterAvailable sinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFP5299 ss-FIREmate-HA- KDEL-IVS-IRES- ManII-SBP- mApple-FIREtag
Plasmid#216695PurposeSynchronize anterograde and retrograde trafficking of ManII between ER and Golgi (RUCH system)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsTagsFIREtag, Streptavidin Binding Protein (SBP), and …ExpressionMammalianMutationcontains only amino acids 1 to 116 of ManIIPromoterCMVAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMH002_phiC31_neo-5xTetO-pEF-H2B-mCitrine-HS4-pRSV-H2B-mCherry
Plasmid#179430PurposeDual fluorescent reporter construct with single HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTRE-cit-HS4-mch (SH)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE (AAV PHP.eB)
Viral prep#104496-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE (#104496). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE plasmid DNA. CAG-driven, Cre-dependent jGCaMP7f calcium sensor. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-axon-jYCaMP1s (AAV1)
Viral prep#135421-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-FLEX-axon-jYCaMP1s (#135421). In addition to the viral particles, you will also receive purified pAAV-syn-FLEX-axon-jYCaMP1s plasmid DNA. Syn-driven, Cre-dependent axon-targeted YCaMP1s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Soma-jGCaMP8m (AAV Retrograde)
Viral prep#169257-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-hSyn-Soma-jGCaMP8m (#169257). In addition to the viral particles, you will also receive purified AAV-hSyn-Soma-jGCaMP8m plasmid DNA. Synapsin-driven expression of soma-targeted calcium sensor jGCaMP8m. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorAvailable sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (AAV2)
Viral prep#100835-AAV2PurposeReady-to-use AAV2 particles produced from pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (#100835). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable sinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.GCaMP6m.WPRE.SV40 (AAV1)
Viral prep#100840-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.GCaMP6m.WPRE.SV40 (#100840). In addition to the viral particles, you will also receive purified pAAV.CAG.GCaMP6m.WPRE.SV40 plasmid DNA. CAG-driven GCaMP6m calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable sinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV CaMKII:RiboL1-jGCaMP8m (AAV8)
Viral prep#239668-AAV8PurposeReady-to-use AAV8 particles produced from pAAV CaMKII:RiboL1-jGCaMP8m (#239668). In addition to the viral particles, you will also receive purified pAAV CaMKII:RiboL1-jGCaMP8m plasmid DNA. Neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8m under the CaMKII promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIAvailable sinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only