We narrowed to 1,541 results for: tetracycline
-
Plasmid#37822DepositorInsertPromotorless gfp reporter gene
Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBTBXh-4
Plasmid#26080DepositorTypeEmpty backboneTagsHisExpressionBacterialAvailable SinceNov. 16, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBMTBX-4
Plasmid#26075DepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pPROBE-TT'
Plasmid#37823DepositorInsertPromotorless gfp reporter gene
Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hARAF-shRNA-1
Plasmid#185370PurposeFor tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAFDepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCVD27
Plasmid#63690Purpose540bp ctxA gene probe EcoRI linkeredDepositorInsertctxA
ExpressionBacterialAvailable SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
DEXsynth:3xhA-ccdb + RUBY
Plasmid#233318PurposeGATEWAY compatible vector with a dexamethasone (DEX)-inducible promoter driving in frame epitope fusion of 3xHA tag paired with ccdb selection toxin and RUBY markerDepositorInsertDEXsynth:3xhA-ccdb + RUBY
UseGateway CloningTags3xHAAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ubi:mTb-ccdb + mcherry
Plasmid#233304PurposeGATEWAY compatible vector with a soybean Ubiquitin (GmUbi) promoter driving in frame epitope fusion of miniTurbo-ID paired with ccdb selection toxin and mCherry markerDepositorInsertUbi:mTb-ccdb + mcherry
UseGateway CloningTagsminiTurbo-IDAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
DEXsynth:mTb-ccdb+ RUBY
Plasmid#233321PurposeGATEWAY compatible vector with a dexamethasone (DEX)-inducible promoter driving in frame epitope fusion miniTurbo-ID paired with ccdb selection toxin and RUBY markerDepositorInsertDEXsynth:mTb-ccdb+ RUBY
UseGateway CloningTagsminiTurbo-IDAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
DEXsynth:3xhA-ccdb + mcherry
Plasmid#233313PurposeGATEWAY compatible vector with a dexamethasone (DEX)-inducible promoter driving in frame epitope fusion of 3xHA tag paired with ccdb selection toxin and mCherry markerDepositorInsertDEXsynth:3xhA-ccdb + mcherry
UseGateway CloningTags3xHAAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ubi:3xHA-ccdb + mcherry
Plasmid#233301PurposeGATEWAY compatible vector with a soybean Ubiquitin (GmUbi) promoter driving in frame epitope fusion of 3xHA tag paired with ccdb selection toxin and mCherry markerDepositorInsertUbi:3xHA-ccdb + mcherry
UseGateway CloningTags3xHAAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MUT_S1-H1,NR
Plasmid#218395Purpose3-exon minigene, with SRSF1 motif-rich middle exon, hnRNPA1 motif-rich region in second intron, both randomly mutated to avoid sequence repeats, and AG>GG mutation in final 3' splice siteDepositorInsertModified CHO DHFR minigene
ExpressionMammalianPromotertetracycline-responsive promoterAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKNOCK-Tc
Plasmid#46259PurposeBacterial targetingDepositorTypeEmpty backboneUseBacterial targetingAvailable SinceAug. 14, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
pTP223
Plasmid#13263DepositorInsertPlac-gam-bet-exo
ExpressionBacterialAvailable SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pFNMB2-msfGFP
Plasmid#113192PurposeMobilizable plasmid for tetracycline inducible gene expression in Francisella novicidaDepositorInsertmsfGFP
Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFNMB1-msfGFP
Plasmid#113191PurposeMobilizable plasmid for tetracycline inducible gene expression in Francisella novicidaDepositorInsertmsfGFP
Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBEST-OR2-OR1-Pr-araC, pBAD-TetR, pBAD-TetO1-deGFP-ssrA
Plasmid#45789DepositorInsertsdeGFP
Tetracycline repressor
araC
UseSynthetic BiologyTagsssrA degradation tagExpressionBacterialPromoterOR2-OR1-Pr (bacteriophage Lambda with one mutatio…Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQFT
Plasmid#203674PurposepQF derivative with promoter PQ5 exchanged for promoter PQJDepositorTypeEmpty backboneTags3xFLAGExpressionBacterialPromoterPQJAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pStA1BZ
Plasmid#114164PurposeStart-Stop Assembly Level 1BZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only