We narrowed to 27,863 results for: sta
-
Plasmid#46406DepositorInsertBks (STAP2 Human)
TagsAviTag, GST, and PreScissionExpressionBacterialMutationcontains amino acids 141-266PromoterTacAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPK1E-2+t-gfp
Plasmid#48132PurposeShuttle vector E. coli/B.meg.; gfp-expression under control of RNAP-K1E-inducible promoterDepositorInsertgfp
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-scFv-GCN4-sfGFP-IRESv4-HaloTag-tdMCP
Plasmid#241137PurposeExpresses Anti-GCN4 scFv-sfGFP and HaloTag-tdMCP to track mature and nascent SunTag-tagged proteins and MS2 tagged mRNADepositorInsertsAnti-GCN4 scFv
tdMCP
TagsHaloTag and sfGFPExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186WT-HA
Plasmid#239774PurposeExpresses WT rat NF186 with a C-terminal HA tag in mammalian cells.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNSE-NF186WT-HA
Plasmid#239781PurposeExpresses WT rat NF186 and with a C-terminal HA tag in mammalian cells.DepositorInsertNfasc (Nfasc Rat)
TagsHA-tagExpressionMammalianPromoterhNSE (obtained from Addgene plasmid #11606)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA376 - pBA904 Puro-T2A-GFP NTC guide (pRCA360 backbone)
Plasmid#238167PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsGFPAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TAK4
Plasmid#227094PurposeLuciferase reporter vector with MMTV 5' Element cloned downstream of luciferase gene in pHMRΔelucDepositorInsertMMTV insert spanning from R region to 400 bp of Gag
UseLuciferaseAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
act-3p(long):rfp
Plasmid#202330PurposeThe act-3 promoter drives expression of TurboRFP in the pharynx, spermatheca, and body wall of C. elegans.DepositorInsertsact-3p(long) promoter
TurboRFP
ExpressionWormPromoterThis is a promoter sequence for C. elegans act-3 …Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
opt.a_pSTC0-zeo
Plasmid#202347PurposeDesign opt.a (greedy optimization without distance constraints) in modified pSTC0 vector in which kan resistance cassette is replaced with zeo resistance cassetteDepositorInsertopt.a
Available SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
opt.b_pSTC0-zeo
Plasmid#202348PurposeDesign opt.b (parallel tempering optimization without distance constraints) in modified pSTC0 vector in which kan resistance cassette is replaced with zeo resistance cassetteDepositorInsertopt.b
Available SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP-SUN1ΔN
Plasmid#213508PurposeExpresses human eGFP-SUNΔN in mammalian cellsDepositorInserteGFP-SUNΔN
ExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_052
Plasmid#216082Purposefor stable fly cell lines; Hygromycin resistance gene; for genome integration by spontaneous insertion, destination vectorDepositorHas ServiceCloning Grade DNAInsertHygromycin resistance gene
UseDestinationExpressionInsectAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor
Plasmid#211905PurposeVector for AAV6 donor production. Targeted CD19-scFv DARIC transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertDARIC-CD19-scFv
UseAAVExpressionMammalianPromoterhPGK1Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SF3B3
Plasmid#156003PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
ptAD-seq-ubi63E-Gal4-DBD
Plasmid#111930PurposeVector to express tAD candidates from a library cloned from fragmented transcription factor coding sequences fused to the Gal4 DNA binding domain.DepositorInserttAD-seq Gal4-DBD
ExpressionInsectAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1D
Plasmid#196686PurposeRep/Cap plasmid for the production of PAL1D, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTFR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Fas.1
Plasmid#196687PurposeRep/Cap plasmid for the production of M.Fas.1, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationTDALTTK insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1B
Plasmid#196684PurposeRep/Cap plasmid for the production of PAL1B, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPSQGTLR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only