We narrowed to 10,309 results for: yeast
-
Plasmid#1238DepositorInsertSUP35 (SUP35 Budding Yeast)
UseYeast integrative plasmidMutationSUP35 middle region (aa124-253) was replaced with…Available SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pCAS9i_TRP
Plasmid#141253PurposeGalactose-inducible expression of Cas9 for addressing one target; Contains guide RNA expression cassette with stuffer and KpnI-Pme1 restriction sites.DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterGAL1 (Cas9), pSNR52 (gRNA)Available SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
p416-GPD-PRUNE-HA
Plasmid#183945PurposeExpresses human HA-tagged PRUNE from yeast GPD promoterDepositorAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pBCSK_HIS3_II
Plasmid#109059Purposeyeast shuttle vector with deletable CEN6-ARSH4 cassette. For teaching purposes.DepositorInsertHIS3 (HIS3 Zygosaccharomyces rouxii, Budding Yeast)
UseCre/LoxExpressionBacterial and YeastPromoterHIS3Available SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBCSK_HIS3_I
Plasmid#109058Purposeyeast shuttle vector with deletable CEN6-ARSH4 cassette. For teaching purposes.DepositorInsertHIS3 (HIS3 Zygosaccharomyces rouxii, Budding Yeast)
UseCre/LoxExpressionBacterial and YeastPromoterHIS3Available SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH340-SUP45(1-242)-GalBD
Plasmid#29740DepositorInsertSUP45 (SUP45 Budding Yeast)
TagsGal Activation domain and MycExpressionYeastMutationCodons 1-242 of the yeast SUP45 gene onlyAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
Sc Pol1-FLAG-pRS402/GAL-L
Plasmid#241975PurposeOver-express Sc Pol1-FLAG (Sc pol alpha - large subunit) in yeast (integrated)DepositorAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc FLAG-S6-RFC1-pRS405/GAL-L
Plasmid#239473PurposeOverexpress Sc FLAG-S6-RFC1 in yeast (integrated)DepositorAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc [Pol31 + Pol32]-pRS403/GAL
Plasmid#239199PurposeOvererxpress Sc Pol31 & Pol32 when integrated into yeast (S. cer)DepositorAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only