We narrowed to 18,764 results for: Mut
-
Plasmid#67644PurposeMBII85 snoRNA expression cassett, contains snoRNA in natural intron sorounded by natural exons. To improve snoRNA expression efficiency 3' splice site was mutated to consensus sequences.DepositorInsertMBII85 snoRNA
ExpressionMammalianMutation3' splice site muattionAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4CTF-PY3 mutant
Plasmid#17799DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 676-1292, …Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
myc GbetaL mutant 7
Plasmid#8481DepositorAvailable SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
myc GbetaL mutant 2
Plasmid#8478DepositorAvailable SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
myc GbetaL mutant 1
Plasmid#8477DepositorAvailable SinceMay 11, 2005AvailabilityAcademic Institutions and Nonprofits only -
myc GbetaL mutant 6
Plasmid#8480DepositorAvailable SinceMay 11, 2005AvailabilityAcademic Institutions and Nonprofits only -
Luc-Nanog-3'UTRmut
Plasmid#63894PurposeLuciferase reporter of mouse Nanog 3'UTR with the miR-34 target site mutatedDepositorInsertNanog homeobox (Nanog Mouse)
ExpressionMammalianAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
CLM RP KGF Mut 1
Plasmid#24166DepositorInsertKinesin (KIF5B Human)
Tags6XHis and GFPExpressionBacterialMutationC7S/C65A/C168A/C174S/C294A/C330S/C421AAvailable SinceMay 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4CTF-PY1 mutant
Plasmid#17798DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 676-1292, …Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGL2 enhancer- F3 Sp-1 mut
Plasmid#22432DepositorAvailable SinceDec. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAG79 3'UTR mut
Plasmid#12056DepositorInsertN2 3'UTR mut
UseLuciferaseExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…Available SinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAG85 3'UTR mut
Plasmid#12059DepositorInsertN5 3'UTR mut
UseLuciferaseExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…Available SinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-R652A
Plasmid#240605PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2; R was substituted by A at Residue 652 of ACE2 in the collectrin-like siteDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) at position 652 on ACE2 is replaced …PromoterCMVAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2-Mutant-R255A
Plasmid#240612PurposeTo test the cleavage of ACE2 by a non-autocleavable form of TMPRSS2 (Less active form)DepositorInsertType II transmembrane serine protease (TMPRSS2 Human)
ExpressionMammalianMutationArginine (R) at position 255 is replaced by alani…PromoterEF-1aAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
XLone-UCE mutant
Plasmid#242185PurposeExpress doxycycline inducible UCE 32S binding mutation of CRNDE in mammalian cellsDepositorInsertCRNDE UCE mutant (CRNDE Human)
ExpressionMammalianMutationATTTTCATGGGC to TAAAAGTACCCGPromoterTRE3GSAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-R671A
Plasmid#240606PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2; R was substituted by A at Residue 671 of ACE2 in the collectrin-like siteDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) at position 671 on ACE2 is replaced …PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-DeltaC4
Plasmid#240609PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2 likely at Cluster 4 of ACE2 in the collectrin-like site. The whole C4 sequence was deleted in this mutantDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationdeletion of the full Cluster 4 sequence on ACE2 (…PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2 GATD1 Alu_Mut1
Plasmid#205470PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertMutant 1 GATD1 Alu Domain
UseLuciferase and RNAiMutationMutated the entire structure of the alu domain wi…PromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2 GATD1 Alu_Mut2
Plasmid#205471PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertMutant 2 GATD1 Alu Domain
UseLuciferase and RNAiMutationMutated the arms of the alu domain by adding ACAC…PromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only