We narrowed to 4,205 results for: SUP
-
Plasmid#203585PurposeExpresses V5-tagged mutant version of EZH1 partially resistant to JQ-EZ-05 in mammalian cells.DepositorInsertEZH1 (EZH1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationchanged Aspartic Acid 745 to Asparagine for parti…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SARS-CoV-2 5’UTR ΔSL1-Luciferase
Plasmid#191481PurposeLuciferase reporter for SARS-CoV-2 5' UTR ΔSL1DepositorInsertSARS-CoV-2 5' UTR ΔSL1
UseLentiviral and LuciferaseMutationMissing the stem-loop 1 region of SARS-CoV-2 5…Available SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4 3xFLAG Halo G-Linker nsp1
Plasmid#175426PurposeExpresses G-linker CoV2 nsp1 in mammalian cells. This contains a 3XFLAG Halo tag fusion to nsp1.DepositorInsertG-linker nsp1
Tags3XFLAG HaloExpressionMammalianMutationG-linker in place of the RNase destabilization do…PromoterCMVAvailable SinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-puro-N3FLAG-MYB-del(TAD)
Plasmid#105597Purposeretrovirally express mouse MYB-del(TAD) with 3*FLAG tag at N terminal and puro resistanceDepositorInsertMYB without TAD domain (Myb Mouse)
UseRetroviralTags3*FLAGExpressionMammalianMutationdeletion of TAD (AA 275-327)PromoterMSCV-LTRAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PIG-TAF4(827-909)
Plasmid#105616Purposeretrovirally express express mouse TAF4 HFD with GFP marker and puro resistanceDepositorAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-fabI-gltA1-gltA2-udhA-gapAP1
Plasmid#87154PurposefabI-gltA1-gltA2-udhA-gapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertfabI-gltA1-gltA2-udhA-GapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (containing miR-21 sites)
Plasmid#62579PurposeTranslational Luciferase Reporter encoding a fragment of the 3'UTR of SPRED1 containing two miR-21 binding sites (sites 1 and 2)DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMiR-CIP2A-stop-mut
Plasmid#53713PurposeLuciferase reporter assay for CIP2A with mutated firefly stop codonDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseMutationMutation on the stop codon of firefly luciferase …Available SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
UAS-DExt (ttv)
Plasmid#41180DepositorAvailable SinceDec. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
KHBD00205
Plasmid#34356DepositorInsertCG8068 (Su(var)2-10 Fly)
UseGateway CloningAvailable SinceJan. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-GATA2-Ala(381-385)
Plasmid#1423DepositorInsertGATA-2 (GATA2 Human)
TagsFLAGExpressionMammalianMutationalanine substitutions at amino acids 381-385Available SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-HK1-3xFLAG
Plasmid#239247PurposeHK1 lentiviral overexpression vectorDepositorInsertHK1 (HK1 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the following silent mutations (c…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-HK2 (D209A, D657A)-3xFLAG
Plasmid#239251PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-MBD1-HK2-3xFLAG
Plasmid#239255PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235297PurposeComMAND open-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235298PurposeComMAND closed-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only