We narrowed to 4,205 results for: SUP
-
Plasmid#236235PurposeAAV expression of human STIM2 internally tagged with HaloTagDepositorInsertHaloTag-STIM2 (STIM2 Human)
UseAAVTagsHaloTag in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-MARINA
Plasmid#223328PurposeDONOR vector for genomic integration of MARINA voltage sensitive indicator gene from Platisa et al., 2017 (10.1021/acschemneuro.6b00234).DepositorInsertsMARINA
KIR2.1 channel Golgi-to-plasma membrane trafficking signal
UseCRISPR and Synthetic BiologyTagsmCherry and super-ecliptic pHluorinExpressionMammalianPromoterCAGAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKS722A
Plasmid#216545PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: S722A) of human PTK2DepositorInsertPTK2 (S722A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation S722AAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKY861F
Plasmid#216546PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: Y861F) of human PTK2DepositorInsertPTK2 (Y861F) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation Y861FAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKS732A
Plasmid#216541PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: S732A) of human PTK2DepositorInsertPTK2 (S732A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation S732AAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKS910A
Plasmid#216542PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: S910A) of human PTK2DepositorInsertPTK2 (S910A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation S910AAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-msEGFP1.8
Plasmid#208619PurposeMammalian expression of a EGFP variant. Mutations were adopted from (Addgene#135301, PMC7508230), named msEGFP1.8 because N-ter and C-ter features of that in msGFP2 (PMC7508230) not included.DepositorInsertmsEGFP1.8
ExpressionMammalianMutation(compared with pEGFP-C1, protein level) S30R, Y39…PromoterCMVAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
SUMO-Twinkle 43-372
Plasmid#205054PurposeTWNK protein expressionDepositorInsertTWNK (TWNK Human)
ExpressionBacterialMutationLacks Mitochondrial localization signal and C ter…Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
SUMO-Twinkle 360-684
Plasmid#205055PurposeTWNK protein expressionDepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta D-Domain
Plasmid#197453PurposeThe plasmid expresses D-domain deleted version of Myc-tagged FBW7 human isoform 1. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW& dimerization domain deleted.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7K404/412/R
Plasmid#200716PurposeThe plasmid expresses Myc-tagged FBW7 human isoform 1 with Lys404 & 412 to Arg mutation. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW7 K404 and K412 mutated to Alanines.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDM304_YFP-IqgC_mRFP-Raf1(RBD)
Plasmid#128698Purposesimultaneous expression of YFP-tagged IqgC and mRFP-tagged active Ras probe (GTPase binding domain from Raf1 kinase) in Dictyostelium discoideum cellsDepositorInsertsiqgC (full length)
Raf1 kinase (aa 50-132)
UseDictyostelium discoideum expression vectorTagsYFP and mRFPMutationnoneAvailable SinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 delta95-114
Plasmid#124925PurposeFor expression of a.a.95-114 deletion mutant of SIN1-GFPDepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 delta116-127
Plasmid#124926PurposeFor expression of a.a.116-127 deletion mutant of SIN1-GFPDepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-neo-sgMYB(human)#4.9
Plasmid#105591Purposelentivirally express gRNA targeting human MYB DBD with GFP marker and neo resistanceDepositorInsertgRNA targeting human MYB DBD
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-neo-sgMYB(human)#5.2
Plasmid#105592Purposelentivirally express gRNA targeting human MYB DBD with GFP marker and neo resistanceDepositorInsertgRNA targeting human MYB DBD
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
GAL-ARF
Plasmid#89121Purposemammalian expression of p14-hARF linked to GAL4 DNA binding domainDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-fabI-gltA1-gltA2-udhA-zwf-gapAP1
Plasmid#87149PurposefabI-gltA1-gltA2-udhA-zwf-gapAP1 targeting guide RNA E. coli, Low Phosphate InductionDepositorInsertfabI-gltA1-gltA2-udhA-zwf-gapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only