We narrowed to 527 results for: lenticrispr
-
Plasmid#244873PurposeKnockout of human UROSDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLentiCRISPR V2 SQLE_sg1
Plasmid#244871PurposeKnockout of human SQLEDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 UROS_sg2
Plasmid#244874PurposeKnockout of human UROSDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 PAPOLA_sg2
Plasmid#244862PurposeKnockout of human PAPOLADepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR PARL sg1
Plasmid#244853PurposeKnockout of human PARLDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR PARL sg2
Plasmid#244854PurposeKnockout of human PARLDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 PAPOLA_sg1
Plasmid#244861PurposeKnockout of human PAPOLADepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgOMA1 sg1
Plasmid#244865PurposeKnockout of human OMA1DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR ATP23 sg1
Plasmid#244847PurposeKnockout of human ATP23DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR ATP23 sg2
Plasmid#244848PurposeKnockout of human ATP23DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgCBS-1
Plasmid#230081PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgCBS-2
Plasmid#230082PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-1
Plasmid#230083PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-2
Plasmid#230084PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-3
Plasmid#230085PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-49535-sgFmr1_CGG5-2
Plasmid#222964PurposeTargeting FMR1 5' UTR for CGG deletionDepositorInsertFMR1 sgRNA (FMR1 Human)
UseCRISPRAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#2
Plasmid#189988PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorInsertPeriod1 (PER1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only