We narrowed to 10,618 results for: KIT
-
Plasmid#73722PurposeSapTrap SNAPtag + Cbr-unc-119 donor plasmidDepositorInsertSnaptag + Cbr-unc-119
UseCRISPR and Cre/LoxExpressionWormAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3043(gRNA XI-1)
Plasmid#73285PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGE6
Plasmid#79476PurposesgRNA shuttle vector; module 1EDepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGE8
Plasmid#79463PurposesgRNA shuttle vector; module 2EDepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
1456_pDEST_miniTol2_R4-R2_Cryst-eGFP
Plasmid#171795PurposepDEST miniTol2-clone for R4-R2 3-component gateway assembly (p5E + pME). Include a eGFP selection marker (Crystallin promoter Lens/Eyes)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMLS236
Plasmid#73684PurposeSapTrap 3-site Destination vector for internal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXs-NKX2.2
Plasmid#134670PurposeRetroviral expression of mouse Nkx2.2DepositorInsertNkx2.2 (Nkx2-2 Mouse)
UseRetroviralAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
EC2_7_dCas9_HC_sgRNA
Plasmid#163711PurposeHigh copy plasmid with dCas9 and sgRNA expression cassettesDepositorInsertdCas9
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB3049(gRNA XII-4)
Plasmid#73291PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMC-1-WDV-LRS-L-11
Plasmid#197720PurposePhytobrick (MoClo) Level 0 PartDepositorInsertWDV LRSL in c-sense with GG expansion to v-sense ORF position
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0013
Plasmid#117549PurposeLevel 1 Golden Gate Cassette: LbCas12a expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + LbCas12a (with stop codon) (pEPOR0SP0007)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB3053(gRNA X-2, XI-5, XII-4)
Plasmid#73295PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-2, XI-5, and XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pExp-Spy
Plasmid#129240PurposeProtein expression in E.coliDepositorTypeEmpty backboneTagsHis and StrepExpressionBacterialPromoterT7Available SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pExp-Calm
Plasmid#129238PurposeProtein expression in E.coliDepositorTypeEmpty backboneTagsHis and StrepExpressionBacterialPromoterT7Available SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFTK093
Plasmid#171365PurposeVector part (LVL1) from the Fungal Modular Cloning ToolKit.DepositorInsertsgRNA transcription unit (MoClo lvl1 unit), P-gpdA-HH-sgRNA-HDV-Ttrpc, replacable LacZ gene
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLaNGo11-7
Plasmid#126055PurposeA self-assembling split-GFP based Golden Gate vector to determine protein targeting to plastids in plant cellDepositorInsertschloroplastic FNR transit peptide
ccdB cassette (BsaI)
GFP11x7 (5 aa linker)
UseBinaryTagsGFP1-10ExpressionPlantAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPTK013-3a-Invertase-αMFΔ
Plasmid#84972PurposeType 3a, Invertase followed by αMFΔ - secretion signalDepositorInsertInvertase followed by αMFΔ secretion tag
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK016-3-RFP_Intra
Plasmid#84975PurposeType 3, Red fluorescent proteinDepositorInsertRed fluorescent protein
UseSynthetic BiologyExpressionYeastMutationBsaI site removed (1677 c to g and 1794 a to g)PromoterNonAvailable SinceMarch 3, 2017AvailabilityAcademic Institutions and Nonprofits only