We narrowed to 25,010 results for: SHR;

#115876

MPHOSPH8 knockdown

Jeremy Luban

Yurkovetskiy et al Nat Microbiol. 2018 Dec;3(12):1354-1361.

Sept. 5, 2019

Academic Institutions and Nonprofits only

#115877

PPHLN1 knockdown

Jeremy Luban

Yurkovetskiy et al Nat Microbiol. 2018 Dec;3(12):1354-1361.

Jan. 10, 2019

Academic Institutions and Nonprofits only

#136054

CAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

Feb. 4, 2020

Academic Institutions and Nonprofits only

#62944

Creating QF2 drivers from MiMIC lines with inserts into coding introns in Phase 0

Benjamin White

Diao et al Cell Rep. 2015 Mar 3;10(8):1410-21. doi:

May 26, 2015

Academic Institutions and Nonprofits only

#62946

Creating QF2 drivers from MiMIC lines with inserts into coding introns in Phase 2

Benjamin White

Diao et al Cell Rep. 2015 Mar 3;10(8):1410-21. doi:

May 1, 2015

Academic Institutions and Nonprofits only

#122289

Knockdown for mouse Hmga1

Yukiko Gotoh

Kishi et al Nat Neurosci. 2012 Aug;15(8):1127-33. do

March 22, 2019

Academic Institutions and Nonprofits only

#78306

Creating LexA::GADfluw lines from MiMIC lines with inserts into coding introns in Phase 1

Benjamin White

Diao et al Cell Rep. 2015 Mar 3;10(8):1410-21. doi:

June 7, 2016

Academic Institutions and Nonprofits only

#11667

3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a Tet-responsive promoter (TREX) controlling expression of GFP and miR30-based shRNA targeting firefly luciferase

Stephen Elledge

Stegmeier et al Proc Natl Acad Sci U S A. 2005 Sep 13. 1

March 1, 2007

Academic Institutions and Nonprofits only

#78307

Creating LexA::GADfluw lines from MiMIC lines with inserts into coding introns in Phase 2

Benjamin White

Diao et al Cell Rep. 2015 Mar 3;10(8):1410-21. doi:

July 8, 2016

Academic Institutions and Nonprofits only

#122288

Knockdown for mouse Hmga1

Yukiko Gotoh

Kishi et al Nat Neurosci. 2012 Aug;15(8):1127-33. do

March 22, 2019

Academic Institutions and Nonprofits only

#160958

Mki67 shRNA in pMKO.1 retroviral vector

Matthew Steinhauser

Zhang et al J Clin Invest. 2018 Nov 1;128(11):4898-4

Dec. 10, 2020

Academic Institutions and Nonprofits only