We narrowed to 4,956 results for: codon optimized
-
Plasmid#120396PurposeExpresses HF2-BE2 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHF2-BE2
ExpressionMammalianMutationMammalian codon-optimized Cas9-HFPromoterCMVAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTMiniTrex-mCherry-Shark3
Plasmid#233145PurposeServes as a template plasmid for amplifying Shark3 (Theo-OFF) hammerhead aptazyme-3xTy-tagging cassetteDepositorInsertsmCherry
Shark3
UseProkaryotic expressionTags3x Ty tagMutationCodon optimized for Trypanosoma cruzi and changed…Available sinceMarch 20, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
piggyBac_rtTA (4th_Gen)_Gateway_IRES_NGN2-2A-PURO_Synapsin-BirA. (pEHA1618)
Plasmid#209084PurposeNgn2 mediated cortical neuron induction, gateway destination, Synapsin promoter BirA ligase expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsExpressionMammalianMutationhuman codon optimizedPromoterhSynAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUW-crRNA-scrambled-U6_TRE-dLbCpf1-NLS-hCTCF_WT-HA-P2A-tagBFP
Plasmid#194897PurposeDox-inducible all-in-one lentiviral construct to express dCpf1-CTCF-WT and scrambled crRNA without target in human genome.DepositorInsertsdLbCpf1-NLS-hCTCF_WT
U6-crRNA-scramble
UseLentiviralTagsHAExpressionMammalianMutationHuman codon optimized catalytically inactive LbCp…PromoterTRE and U6Available sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetOn-ND-Cdt1-mCherry
Plasmid#193761PurposeDoxycyline-inducible (TetOn) human Cdt1 (SV40 NLS localization and C-terminal mCherry tag) with mutations which abroggate its S phase degradationDepositorInsertND-Cdt1-mCherry (CDT1 Human)
UseLentiviralTagsmCherryMutationamino acids 1-19 deleted, ΔCy mutation (aa68-70 t…PromoterTREAvailable sinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-BaLgp140-8his
Plasmid#100924PurposeMammalian expression plasmid for soluble gp140 from the BaL HIV-1 strainDepositorInsertHIV-1 (BaL) Env
TagsCD5 leader sequence and Purification tag after D6…ExpressionMammalianMutationCodon-optimized synthetic genePromoterCMVAvailable sinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFS_1064_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)-3xTerm_J23106-Leader-ARRAY2-DR2-FaqI_Term_NotI
Plasmid#184739Purposeencodes aTc inducible FsRT-Cas1–Cas2 expression cassette and FsCRISPR Array 2 transcribed by BBa_J23106DepositorInsertFsRT-Cas1(opt)-Cas2(opt)
ExpressionBacterialMutationsequence codon optimized for expression in E. coliPromoterpTetAAvailable sinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HCMVgO-8his (TB40/E)
Plasmid#136453PurposeMammalian expression plasmid for HCMV glycoprotein O (TB40/E strain) with an 8his tagDepositorInsertenvelope glycoprotein O (UL74 Human betaherpesvirus 5)
TagsLinker and 8his tag (GGSGHHHHHHHH, includes BamHI…ExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable sinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A11.T)
Viral prep#157970-AAV.A11.TPurposeReady-to-use AAV44.9 in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable sinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
piggyBac_rtTA (4th_Gen)_SNCA_IRES_NGN2-2A-PURO_Synapsin-BirA (pEHA1623)
Plasmid#209085PurposeNgn2 mediated cortical neuron induction, SNCA(wt) expression, Synapsin promoter BirA ligase expressionDepositorExpressionMammalianMutationhuman codon optimizedPromoterTRE4G and hSynAvailable sinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A06.T)
Viral prep#157970-AAV.A06.TPurposeReady-to-use AAV2 (trpYF) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable sinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HCMVgO-sfGFP (Merlin)
Plasmid#136452PurposeMammalian expression plasmid for HCMV glycoprotein O (Merlin strain) fused to superfolder GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertglycoprotein O (UL74 Human betaherpesvirus 5)
TagsGly/Ser-rich linker (GGSGGSGSGG) (includes BamHI …ExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable sinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
piggyBac_rtTA (4th_Gen)_SNCA-Avi_IRES_NGN2-2A-PURO_Synapsin-BirA (pEHA1628)
Plasmid#209086PurposeNgn2 mediated cortical neuron induction, SNCA(Avi tagged) expression, Synapsin promoter BirA ligase expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNATagsAviTagExpressionMammalianMutationhuman codon optimizedPromoterTRE4G and hSynAvailable sinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTUB1-Spy.dCas9-CAT-U6-sgRNA(decoy)
Plasmid#171089PurposeCRISPR interference. Construct for expressing catalytically inactive Cas9 (dCas9) from Streptococcus pyogenes in Toxoplasma gondii. Suitable for generating stable cell lines.DepositorInsertsDecoy sgRNA
dCas9
Chloramphenicol acetyltransferase
UseCRISPR; Toxoplasma gondii expressionTags3X FLAG and Nuclear Localization SignalMutationD10A, H840APromoterTUB1 (Toxoplasma gondii) and U6 (Toxoplasma gondi…Available sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-QES.i03.c01-8his
Plasmid#111846PurposeMammalian expression plasmid for soluble BG505 SOSIP.664; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 Env (BG505 SOSIP.664)
Tags8his purification tag and CD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; has SOSIP mutatio…PromoterCMVAvailable sinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_hsHAUScomplex_FL
Plasmid#202203PurposeBaculoviral transfer vector to co-express 8 subunits of human augmin complexDepositorInsertsHAUS1 (HAUS1 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS3 (HAUS3 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS2 (HAUS2 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS6 (HAUS6 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS7 (HAUS7 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS4 (HAUS4 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS5 (HAUS5 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS8 (HAUS8 codon-optimized form for expression in Trichoplusia ni cells, Human)
Tags-mGFP-TEV-TwinStrep and His-tag (6x)ExpressionInsectPromoterpolyhedrin promoterAvailable sinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-QES.i03.c01-TM
Plasmid#111845PurposeMammalian expression plasmid for BG505 SOSIP.664 fused to a transmembrane tether; QES mutant with enhanced binding to PG16DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHIV-1 Env (BG505 SOSIP.664)
TagsCD5 leader sequence and TM helix from MHC class IExpressionMammalianMutationCodon-optimized synthetic gene; has SOSIP mutatio…PromoterCMVAvailable sinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas3
Plasmid#229538PurposepMV_hyg encoding Cas3(wt) and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloning.DepositorInsertCas3
UseCRISPRExpressionBacterial and YeastMutationcodon optimized for S.cerevisiaeAvailable sinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only