We narrowed to 23,480 results for: CRISPR
-
Plasmid#80937PurposeExpresses Cas9N in mammalian cells; expresses gRNA M4 for Mstn cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHS641_Flex-Cas12a-ABE
Plasmid#244846PurposeMammalian expression of Flex-Cas12a adenine base editorDepositorInsertFlex-dCas12a-ABE
UseCRISPRTagsSV40 NLS-ABE8eExpressionMammalianMutationG146R/R182V/D535G/S551F/D665N/E795Q/D832APromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT16
Plasmid#223388PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT41
Plasmid#223413PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants select.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT15
Plasmid#223387PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpCas9-D10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT17
Plasmid#223389PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT23
Plasmid#223395PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpRYD10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT26
Plasmid#223398PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for dicot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and the sgRNA was driven by AtU3; BASTA for plants select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT28
Plasmid#223400PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and sgRNA was driven by OsU3; Hygromycin for plant select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT29
Plasmid#223401PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and the sgRNA was driven by OsU3; BASTA for plant select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT30
Plasmid#223402PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 and the sgRNA was driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT14
Plasmid#223386PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and sgRNA was by AtU3; BASTA for plant selection.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRTagsExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRTagsExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRTagsExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEL1022
Plasmid#225593PurposeThe backbone vector for rice genome editing is based on HkCas12aDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEL1023
Plasmid#225594PurposeThe backbone vector for rice genome editing is based on PrCas12aDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Apr
Plasmid#208000PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorUseTagsExpressionMammalianMutationPromoterAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-Cas13d
Plasmid#224789PurposeLPUtopia matching RMCE donor plasmid with mCherry-P2A-RfxCas13d Negative-Feedback circuit. Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertmCherry-P2A-RfxCas13d
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only