We narrowed to 4,396 results for: 256
-
Plasmid#23613DepositorInsertHKDC1 (HKDC1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE6 (plus strand)
Plasmid#91839PurposeLuciferase reporter for IL2RA enhancer (IGI-P0616)DepositorInsertIL2RA CaRE6 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893467 G>T, rs11256448 A>GAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 1
Plasmid#183828PurposeExpress EML4-ALK fusion variant 1 (E13;A20) in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-13 and ALK exon…ExpressionMammalianPromoterCMVAvailable SinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 3a
Plasmid#183829PurposeExpress EML4-ALK fusion variant 3a (E6a;A20) in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-6a and ALK exon…ExpressionMammalianPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYO395
Plasmid#235734PurposeExpression of human VPS34 complex I in mammalian cellsDepositorTagsZZ-3xTEVExpressionMammalianMutationN256SPromoterCMVAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEMS1261
Plasmid#29133PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceOct. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1262
Plasmid#29134PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceOct. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1260
Plasmid#29132PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1263
Plasmid#29135PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceOct. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1686
Plasmid#29291PurposeExpression of the reporter gene was not detected in the brain and eye using LacZ.DepositorInsertPle214 (TAC1 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceJune 10, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-EML4-ALK variant 3a G1202R
Plasmid#183830PurposeExpress EML4-ALK fusion variant 3a (E6a;A20) harboring ALK G1202R mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-6a and ALK exon…ExpressionMammalianMutationG1202RPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 3a L1196M/G1202R
Plasmid#183831PurposeExpress EML4-ALK fusion variant 3a (E6a;A20) harboring ALK L1196M/G1202R mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-6a and ALK exon…ExpressionMammalianMutationL1196M/G1202RPromoterCMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMO15
Plasmid#235735PurposeExpression of human VPS34 complex I + NRBF2 in mammalian cellsDepositorInsertsTagsZZ-3xTEVExpressionMammalianMutationN256SPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
TUNEYALI Kit
Plasmid Kit#1000000255PurposeUse the TUNEYALI kit for precise regulation of transcription factor expression in Yarrowia lipolytica.DepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
Target Accelerator Genetic Pathway Reference Set
Plasmid Kit#1000000105PurposeCollection of genes and mutations for reference pathway signatures and phenotypes to compare with those derived from cancer alleles; represent over 25 cellular signaling pathways and processesDepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
AdenoBuilder toolkit
Plasmid Kit#1000000176PurposePlasmids containing modular inserts that span the human adenovirus serotype 5 (HAdV5) genome that can be assembled in a one-tube reaction.DepositorAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
SapTrap Kit
Plasmid Kit#1000000077PurposeSapTrap: modular toolkit for building CRISPR/Cas9 targeting vectors to insert genetic tags in C. elegans genome. 21 vector assembly plasmids, Unc-32::GFP targeting vector, 5 Cre/Flp expression vectorsDepositorAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only