We narrowed to 8,779 results for: chloramphenicol

#53544

Inhibition module. Constructed from the parent plasmids pLuxRI, pLuxmCherry, pET15bLCFPT7, and pLysS. The plasmid can express T7 lysozyme by inducing AHL and LuxR. Chloramphenicol resistance

Lingchong You

Payne et al Mol Syst Biol. 2013 Oct 8;9:697. doi: 10

March 26, 2015

Academic Institutions and Nonprofits only

#84459

pJB38-NWMN29-30 + SarA_P1-DsRed-Term

Reindert Nijland

de Jong et al Sci Rep. 2017 Mar 7;7:43889. doi: 10.103

Feb. 17, 2017

Academic Institutions and Nonprofits only

#225769

This is the native promoter from the catP chloramphenicol resistance cassette.

Nili Ostrov

Gilbert et al bioRxiv 2025.12.22.696024

Sept. 26, 2024

Academic Institutions and Nonprofits only

#48650

Bacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 17, 2013

Academic Institutions and Nonprofits only

#48656

Bacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 17, 2013

Academic Institutions and Nonprofits only

#126983

Level 1 vector with alternative selection marker (chloramphenicol). OriV 9 (pBBR322/ROP; medium copy number); sfGFP cloning reporter.

Chris French

Valenzuela-Ortega et al Synth Biol (Oxf). 2021 Feb 2;6(1):ysab00

July 31, 2019

Academic Institutions and Nonprofits only

#48651

Bacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 17, 2013

Academic Institutions and Nonprofits only

#48655

Bacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 17, 2013

Academic Institutions and Nonprofits only

#48654

Bacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 17, 2013

Academic Institutions and Nonprofits only