We narrowed to 23,297 results for: promoter
-
Plasmid#227268PurposeEmpty AAVS1 targeting donor for the insertion of Zeo and a strong EF1a promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteTagsExpressionMammalianMutationPromoterAvailable sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3-hBcan
Plasmid#18966DepositorInsertBrevican (BCAN Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E1.1-RFP
Plasmid#22928DepositorInsertE1.1 binding site from Scardigli et al., 2003 with minimal CMV
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
FL-BCAN-lentiviral-GFP
Plasmid#29704DepositorInsertBrevican (BCAN Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pscALPS gag-gfp/vpx
Plasmid#115808PurposeSFFV promoter expresses gag-gfp fusion with CypA promoter driving expression of SIVMAC251 vpxDepositorInsertgag-gfp
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS gag-gfp/deltavpx
Plasmid#115807PurposeSFFV promoter expresses gag-gfp fusion with no ORF after CypA promoterDepositorInsertgag-gfp
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)ExpressionMutationCodon optimizedPromoterAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBabe-puro-Smad4-Flag
Plasmid#37041DepositorInsertSmad4 (SMAD4 Human)
UseRetroviralTagsFlagExpressionMammalianMutationPromoter5'LTRAvailable sinceMarch 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL3 GATA Luc
Plasmid#85695PurposeLuciferase reporter containing three repeats of the GATA consensus siteDepositorInsert3xGATA and minimal MT promoter
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoter3xGATA and minimal MT promoterAvailable sinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-rnSOX9
Plasmid#62972PurposeExpresses HA-tagged rat SOX9DepositorInsertSOX9 (Sox9 Rat)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-PKCA D463N
Plasmid#195203PurposeMammalian expression vector for GFP tagged PKCA. Kinase-inactive mutantDepositorInsertPRKCA (PRKCA Human)
UseTagsExpressionMammalianMutationD463NPromoterAvailable sinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
His10-PS-SNAPf (XSB522)
Plasmid#78512PurposeConstruct for expressing His10 - SNAPf in E. ColiDepositorInsertSNAPf
UseTagsHis10 followed by a prescission protease claevage…ExpressionBacterialMutationPromoterAvailable sinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
hOC-GFPtpz
Plasmid#110207PurposeExpresses GFP in mature bone cells.DepositorInserteGFPtopaz
UseTagsNoneExpressionMammalianMutationPromoterHuman osteocalcin (BGLAP)Available sinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACT2-CAS9c
Plasmid#51055PurposeExpress Eukaryotic-codon-optimized Cas9c gene in yeast under ADH1 promoter for genome editing. SV40 NLS is fused to the C terminal. GAL4 region from pACT2 is removed.DepositorInsertCas9c
UseCRISPRTagsSV40 NLSExpressionBacterial and YeastMutationPromoteryeast ADH1 promoterAvailable sinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTRE2-Bla(HA–RILP)
Plasmid#102425PurposeHA tag fused to the N-terminus of RILP for the expression in mammalian cells.DepositorInsertRab interacting lysosomal protein (RILP Human)
UseTagsHAExpressionMammalianMutationPromoterTet-responsiveAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBP-J23100
Plasmid#72963PurposeLevel 0 - J23100 standard iGEM promoter (5' CTAT/3' GTAC fusion)DepositorInsertJ23100 promoter
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crScaffold_SV40-BFP
Plasmid#224860PurposecrRNA scaffold for RfxCas13d expressed from hU6 promoter and reporter BFP protein expressed from SV40 promoterDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterhU6Available sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZmUbi-5'UTR
Plasmid#154057PurposeLevel 0 Golden Gate vector, containing the ZmUbi promoter and 5' UTR with Level 0.5-compatible overhangs (Wheat construct)DepositorInsertPromoter and 5' UTR Ubiquitin (Zea mays)
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterN/AAvailable sinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-intron
Plasmid#177804PurposeAn intron is inserted into the DsRed gene with a nuclear transfer signal and a 3xFlag tag. The intron can be digested with EcoRV and any pre-miRNA can be inserted.DepositorInsertintron
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only